14 resultados para Dye penetration

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

To evaluate the influence of a fluorescent dye (rhodamine B) on the physical and mechanical properties of three different luting cements: a conventional adhesive luting cement (RelyX ARC, 3M/ESPE), a self-adhesive luting cement (RelyX U-200, 3M/ESPE), and a self-etching and self-adhesive luting cement (SeT PP, SDI). The cements were mixed with 0.03 wt% rhodamine B, formed into bar-shaped specimens (n = 10), and light cured using an LED curing unit (Radii, SDI) with a radiant exposure of 32 J/cm(2) . The Knoop hardness (KHN), flexural strength (FS), and Young's modulus (YM) analyses were evaluated after storage for 24 h. Outcomes were subjected to two-way ANOVA and Tukey's test (P = 0.05) for multiple comparisons. No significant differences in FS or YM were observed among the tested groups (P ≥ 0.05); the addition of rhodamine B increased the hardness of the luting cements tested. The addition of a fluorescent agent at 0.03 wt% concentration does not negatively affect the physical-mechanical properties of the luting cement polymerization behavior.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study evaluated the ecotoxicity of five dyes to freshwater organisms before and during their photo-Fenton degradation. EC50 (48h) of the five tested dyes ranged from of 6.9 to >1000mgL(-1) for Daphnia similis. In the chronic tests IC50 (72h) varied from 65 to >100mgL(-1) for Pseudokirchneriella subcapitata and IC50 (8 days) from 0.5 to 410mgL(-1) for Ceriodaphnia dubia. Toxicity tests revealed that although the applied treatment was effective for decolorization of the dye, the partial mineralization may be responsible for the presence of degradation products which can be either more toxic than the original dye, as is the case of Vat Green 3 and Reactive Black 5, lead to initially toxic products which may be further degraded to non toxic products (acid Orange 7 and Food Red 17), or generate non toxic products as in the case of Food Yellow 3. The results highlighted the importance of assessing both acute and chronic toxicity tests of treated sample before effluent discharge.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The development and maintenance of the sealing of the root canal system is the key to the success of root canal treatment. The resin-based adhesive material has the potential to reduce the microleakage of the root canal because of its adhesive properties and penetration into dentinal walls. Moreover, the irrigation protocols may have an influence on the adhesiveness of resin-based sealers to root dentin. The objective of the present study was to evaluate the effect of different irrigant protocols on coronal bacterial microleakage of gutta-percha/AH Plus and Resilon/Real Seal Self-etch systems. One hundred ninety pre-molars were used. The teeth were divided into 18 experimental groups according to the irrigation protocols and filling materials used. The protocols used were: distilled water; sodium hypochlorite (NaOCl)+eDTA; NaOCl+H3PO4; NaOCl+eDTA+chlorhexidine (CHX); NaOCl+H3PO4+CHX; CHX+eDTA; CHX+ H3PO4; CHX+eDTA+CHX and CHX+H3PO4+CHX. Gutta-percha/AH Plus or Resilon/Real Seal Se were used as root-filling materials. The coronal microleakage was evaluated for 90 days against Enterococcus faecalis. Data were statistically analyzed using Kaplan-Meier survival test, Kruskal-Wallis and Mann-Whitney tests. No significant difference was verified in the groups using chlorhexidine or sodium hypochlorite during the chemo-mechanical preparation followed by eDTA or phosphoric acid for smear layer removal. The same results were found for filling materials. However, the statistical analyses revealed that a final flush with 2% chlorhexidine reduced significantly the coronal microleakage. A final flush with 2% chlorhexidine after smear layer removal reduces coronal microleakage of teeth filled with gutta-percha/AH Plus or Resilon/Real Seal SE.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Staphylococcus aureus aggravates the allergic eosinophilic inflammation. We hypothesized that Staphylococcus aureus-derived enterotoxins directly affect eosinophil functions. Therefore, this study investigated the effects of Staphylococcal enterotoxins A and B (SEA and SEB) on human and mice eosinophil chemotaxis and adhesion in vitro, focusing on p38 MAPK phosphorylation and intracellular Ca(2+) mobilization. Eosinophil chemotaxis was evaluated using a microchemotaxis chamber, whereas adhesion was performed in VCAM-1 and ICAM-1-coated plates. Measurement of p38 MAPK phosphorylation and intracellular Ca(2+) levels were monitored by flow cytometry and fluorogenic calcium-binding dye, respectively. Prior incubation (30 to 240 min) of human blood eosinophils with SEA (0.5 to 3 ng/ml) significantly reduced eotaxin-, PAF- and RANTES-induced chemotaxis (P<0.05). Likewise, SEB (1 ng/ml, 30 min) significantly reduced eotaxin-induced human eosinophil chemotaxis (P<0.05). The reduction of eotaxin-induced human eosinophil chemotaxis by SEA and SEB was prevented by anti-MHC monoclonal antibody (1 μg/ml). In addition, SEA and SEB nearly suppressed the eotaxin-induced human eosinophil adhesion in ICAM-1- and VCAM-1-coated plates. SEA and SEB prevented the increases of p38 MAPK phosphorylation and Ca(2+) levels in eotaxin-activated human eosinophils. In separate protocols, we evaluated the effects of SEA on chemotaxis and adhesion of eosinophils obtained from mice bone marrow. SEA (10 ng/ml) significantly reduced the eotaxin-induced chemotaxis along with cell adhesion to both ICAM-1 and VCAM-1-coated plates (P<0.05). In conclusion, the inhibition by SEA and SEB of eosinophil functions (chemotaxis and adhesion) are associated with reductions of p38 MAPK phosphorylation and intracellular Ca(2+) mobilization.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The inflation pressure of the endotracheal tube cuff can cause ischemia of the tracheal mucosa at high pressures; thus, it can cause important tracheal morbidity and tracheal microaspiration of the oropharyngeal secretion, or it can even cause pneumonia associated with mechanical ventilation if the pressure of the cuff is insufficient. In order to investigate the effectiveness of the RUSCH® 7.5 mm endotracheal tube cuff, this study was designed to investigate the physical and mechanical aspects of the cuff in contact with the trachea. For this end, we developed an in vitro experimental model to assess the flow of dye (methylene blue) by the inflated cuff on the wall of the artificial material. We also designed an in vivo study with 12 Large White pigs under endotracheal intubation. We instilled the same dye in the oral cavity of the animals, and we analyzed the presence or not of leakage in the trachea after the region of the cuff after their deaths (animal sacrifice). All cuffs were inflated at the pressure of 30 cmH2O. We observed the passage of fluids through the cuff in all in vitro and in vivo experimental models. We conclude that, as well as several other cuff models in the literature, the RUSCH® 7.5 mm tube cuffs are also not able to completely seal the trachea and thus prevent aspiration of oropharyngeal secretions. Other prevention measures should be taken.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Type 1 diabetes (T1D) is provoked by an autoimmune assault against pancreatic β cells. Exercise training enhances β-cell mass in T1D. Here, we investigated how exercise signals β cells in T1D condition. For this, we used several approaches. Wild-type and IL-6 knockout (KO) C57BL/6 mice were exercised. Afterward, islets from control and trained mice were exposed to inflammatory cytokines (IL-1β plus IFN-γ). Islets from control mice and β-cell lines (INS-1E and MIN6) were incubated with serum from control or trained mice or medium obtained from 5-aminoimidazole-4 carboxamide1-β-d-ribofuranoside (AICAR)-treated C2C12 skeletal muscle cells. Subsequently, islets and β cells were exposed to IL-1β plus IFN-γ. Proteins were assessed by immunoblotting, apoptosis was determined by DNA-binding dye propidium iodide fluorescence, and NO(•) was estimated by nitrite. Exercise reduced 25, 75, and 50% of the IL-1β plus IFN-γ-induced iNOS, nitrite, and cleaved caspase-3 content, respectively, in pancreatic islets. Serum from trained mice and medium from AICAR-treated C2C12 cells reduced β-cell death, induced by IL-1β plus IFN-γ treatment, in 15 and 38%, respectively. This effect was lost in samples treated with IL-6 inhibitor or with serum from exercised IL-6 KO mice. In conclusion, muscle contraction signals β-cell survival in T1D through IL-6.-Paula, F. M. M., Leite, N. C., Vanzela, E. C., Kurauti, M. A., Freitas-Dias, R., Carneiro, E. M., Boschero, A. C., and Zoppi, C. C. Exercise increases pancreatic β-cell viability in a model of type 1 diabetes through IL-6 signaling.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The behaviour of Nafion® polymeric membranes containing acid-base dyes, bromothymol blue (BB) and methyl violet (MV), were studied aiming at constructing an optical sensor for pH measurement. BB revealed to be inadequate for developing sensing phases due to the electrostatic repulsion between negative groups of their molecules and the negative charge of the sulfonate group of the Nafion®, which causes leaching of the dye from the membrane. On the other hand, MV showed to be suitable due to the presence of positive groups in its structure. The membrane prepared from a methanolic solution whose Nafion®/dye molar ratio was 20 presented the best analytical properties, changing its color from green to violet in the pH range from 0.6 to 3.0. The membrane can be prepared with good reproducibility, presenting durability of ca. 6 months and response time of 22 s, making possible its use for pH determination in flow analysis systems.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The adsorption capacity of alpha-chitosan and its modified form with succinic anhydride was compared with the traditional adsorbent active carbon by using the dye methylene blue, employed in the textile industry. The isotherms for both biopolymers were classified as SSA systems in the Giles model, more specifically in L class and subgroup 3. The dye concentration in the supernatant in the adsorption assay was determined through electronic spectroscopy. By calorimetric titration thermodynamic data of the interaction between methyene blue and the chemically modified chitosan at the solid/liquid interface were obtained. The enthalpy of the dye/chitosan interaction gave 2.47 ± 0.02 kJ mol-1 with an equilibrium constant of 7350 ± 10 and for the carbon/dye interaction this constant gave 5951 ± 8. The spontaneity of these adsorptions are reflected by the free Gibbs energies of -22.1 ± 0.4 and -21.5 ± 0.2 kJ mol-1, respectively, found for these systems. This new adsorbent derived from a natural polysaccharide is as efficient as activated carbon. However 97% of the bonded dye can be eluted by sodium chloride solution, while this same operation elutes only 42% from carbon. Chitosan is efficient in dye removal with the additional advantage of being cheap, non-toxic, biocompatible and biodegradable.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper presents two techniques to evaluate soil mechanical resistance to penetration as an auxiliary method to help in a decision-making in subsoiling operations. The decision is based on the volume of soil mobilized as a function of the considered critical soil resistance to penetration in each case. The first method, probabilistic, uses statistical techniques to define the volume of soil to be mobilized. The other method, deterministic, determines the percentage of soil to be mobilized and its spatial distribution. Both cases plot the percentage curves of experimental data related to the soil mechanical resistance to penetration equal or larger to the established critical level and the volume of soil to be mobilized as a function of critical level. The deterministic method plots showed the spatial distribution of the data with resistance to penetration equal or large than the critical level. The comparison between mobilized soil curves as a function of critical level using both methods showed that they can be considered equivalent. The deterministic method has the advantage of showing the spatial distribution of the critical points.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This work was carried out with the objective of studying the spatial variability of the physical attributes of a Red-Yellow Ultisol under pasture and secondary vegetation in natural regeneration. Two areas were chosen in a hillside, with the soil sampling to the depth of 0-0.2 m, with the georeferenced points in a regular grid of 10x10 m, totalizing 64 points. In each point it was evaluated the total volume of porosity, macroporosity, microporosity, bulk density, soil penetration resistance and soil water content. The studied attributes in the pasture area present indicator of soil compaction for the animals' traffic, with moderate and strong structure of spatial dependence, except for the macroporosity and penetration resistance. In the area of secondary vegetation (VN) only the macroporosity does not present spatial dependence. The total volume of porosity and the bulk density present the same spatial standard in the area under pasture.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of this study was to compare two methods of surface roughness analysis, perfilometry and spectrophotometry, applied to the surface of ionomeric materials (Chelon Fil, Vitremer and Dyract), submitted to different surface finishing treatments. For the perfilometric analysis, sixty specimens of each material were made and randomly separated into three experimental groups. The average surface roughness (Ra, mm) was measured on each specimen by a surface perfilometer (Mitutoyo Surftest 211). The spectrophotometric analysis consisted in quantifying the dye impregnated in the samples. The dyes used were 0.5% fuchsin and 0.5% erythrosin. Data were submitted to variance analysis (ANOVA) and t-Student test at a 0.05 significance level. There was no linear correlation between average roughness and superficial deposition of dye. Perfilometric analysis revealed that 12- and 30-bladed carbide burs caused the roughest surface of Chelon Fil, followed by Sof-Lex discs and mylar band. There were no significant differences between the specimens submitted to finishing and polishing with Sof-Lex discs and the control group (mylar band) for Vitremer, nevertheless, the highest Ra values were obtained when 12- and 30-bladed burs were used. For Dyract, there was no significant difference between the three treatments. The mean values of superficial deposition of dye for Chelon Fil, Vitremer and Dyract were: 1.7261, 1.4759, 1.3318, respectively. There were no significant differences between the restorative materials when different finishing and polishing systems were used.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Culture supernatant of Staphylococcus aureus 722 in 3% triptone plus 1% yeast extract was used for EEA purification, proceeding comparison between dye ligand Red A affinity chromatography and classic chromatography. The capture of SEA with Amberlite CG-50 allowed rapid enterotoxin concentration from the culture supernatant. However, the ratio of 15 mg of the resin to a total of 150 mg of the toxin satured the resin, giving only 10 to 30% of SEA recuperation from the supernatant. The elution of concentrated material throught the Red A column resulted in a recovery of 60,87% of the toxin, and required 76 hours, indicating advantage on classic chromatography. Ion exchange column plus gel filtration recovered only 6,5 % of the SEA, and required 114 hours to conclude the procedure. The eletrophoresis of purified SEA indicated high grade of toxin obtained from Red A column, with 90 % of purity, compared to 60 % of classic column.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física