A Microleakage Study Of Gutta-percha/ah Plus And Resilon/real Self-etch Systems After Different Irrigation Protocols.

The development and maintenance of the sealing of the root canal system is the key to the success of root canal treatment. The resin-based adhesive material has the potential to reduce the microleakage of the root canal because of its adhesive properties and penetration into dentinal walls. Moreover, the irrigation protocols may have an influence on the adhesiveness of resin-based sealers to root dentin. The objective of the present study was to evaluate the effect of different irrigant protocols on coronal bacterial microleakage of gutta-percha/AH Plus and Resilon/Real Seal Self-etch systems. One hundred ninety pre-molars were used. The teeth were divided into 18 experimental groups according to the irrigation protocols and filling materials used. The protocols used were: distilled water; sodium hypochlorite (NaOCl)+eDTA; NaOCl+H3PO4; NaOCl+eDTA+chlorhexidine (CHX); NaOCl+H3PO4+CHX; CHX+eDTA; CHX+ H3PO4; CHX+eDTA+CHX and CHX+H3PO4+CHX. Gutta-percha/AH Plus or Resilon/Real Seal Se were used as root-filling materials. The coronal microleakage was evaluated for 90 days against Enterococcus faecalis. Data were statistically analyzed using Kaplan-Meier survival test, Kruskal-Wallis and Mann-Whitney tests. No significant difference was verified in the groups using chlorhexidine or sodium hypochlorite during the chemo-mechanical preparation followed by eDTA or phosphoric acid for smear layer removal. The same results were found for filling materials. However, the statistical analyses revealed that a final flush with 2% chlorhexidine reduced significantly the coronal microleakage. A final flush with 2% chlorhexidine after smear layer removal reduces coronal microleakage of teeth filled with gutta-percha/AH Plus or Resilon/Real Seal SE.

Understanding Red Blood Cell Parameters In The Context Of The Frailty Phenotype: Interpretations Of The Fibra (frailty In Brazilian Seniors) Study.

Frailty and anemia in the elderly appear to share a common pathophysiology associated with chronic inflammatory processes. This study uses an analytical, cross-sectional, population-based methodology to investigate the probable relationships between frailty, red blood cell parameters and inflammatory markers in 255 community-dwelling elders aged 65 years or older. The frailty phenotype was assessed by non-intentional weight loss, fatigue, low grip strength, low energy expenditure and reduced gait speed. Blood sample analyses were performed to determine hemoglobin level, hematocrit and reticulocyte count, as well as the inflammatory variables IL-6, IL-1ra and hsCRP. In the first multivariate analysis (model I), considering only the erythroid parameters, Hb concentration was a significant variable for both general frailty status and weight loss: a 1.0g/dL drop in serum Hb concentration represented a 2.02-fold increase (CI 1.12-3.63) in an individual's chance of being frail. In the second analysis (model II), which also included inflammatory cytokine levels, hsCRP was independently selected as a significant variable. Each additional year of age represented a 1.21-fold increase in the chance of being frail, and each 1-unit increase in serum hsCRP represented a 3.64-fold increase in the chance of having the frailty phenotype. In model II reticulocyte counts were associated with weight loss and reduced metabolic expenditure criteria. Our findings suggest that reduced Hb concentration, reduced RetAbs count and elevated serum hsCRP levels should be considered components of frailty, which in turn is correlated with sarcopenia, as evidenced by weight loss.

Hemodynamic, Ventilatory And Gasometric Evaluation Of An Experimental Bronchopleural Fistula.

To investigate the hemodynamic and ventilatory changes associated with the creation of an experimental bronchopleural fistula (BPF) treated by mechanical ventilation and thoracic drainage with or without a water seal. Six large white pigs weighing 25 kg each which, after general anesthesia, underwent endotracheal intubation (6mm), and mechanically ventilation. Through a left thoracotomy, a resection of the lingula was performed in order to create a BPF with an output exceeding 50% of the inspired volume. The chest cavity was closed and drained into the water sealed system for initial observation of the high output BPF. Significant reduction in BPF output and PaCO2 was related after insertion of a water-sealed thoracic drain, p< 0.05. Insertion of a water-sealed thoracic drain resulted in reduction in bronchopleural fistula output and better CO2 clearance without any drop in cardiac output or significant changes in mean arterial pressure.

Possibilidades e limitações no uso da temperatura em cromatografia líquida de fase reversa

High-temperature liquid chromatography (HTLC) is a technique that presents a series of advantages in liquid phase separations, such as: reduced analysis time, reduced pressure drop, reduced asymmetry factors, modified retentions, controlled selectivities, better efficiencies and improved detectivities, as well as permitting green chromatography. The practical limitations that relate to instrumentation and to stationary phase instability are being resolved and this technique is now ready to be applied for routine determinations.

Determinação da densidade de corrente de corrosão em meios de baixa condutividade: uso de microeletrodos para minimizar a queda ôhmica

The gravimetric and electrochemical tests are the most common techniques used in determining the corrosion rate. However, the use of electrochemical polarization is limited to electrolytes with sufficient conductivity for which Tafel curves are linear. In this study, we investigated a technique in which working microelectrodes of AISI 1020 steel were used to obtain the Tafel curves in diesel oil. The strategy was to reduce the electrode area and hence the ohmic drop. The diameter of the microelectrode was reduced to a value where the compensation of the Tafel curves became unnecessary. The results showed that for electrodes with diameters below 50 μm, the ohmic drop tends to a minimum and independent of the microelectrode diameter.

Métodos probabilístico e determinístico para diagnóstico da necessidade de subsolagem de solos agrícolas

This paper presents two techniques to evaluate soil mechanical resistance to penetration as an auxiliary method to help in a decision-making in subsoiling operations. The decision is based on the volume of soil mobilized as a function of the considered critical soil resistance to penetration in each case. The first method, probabilistic, uses statistical techniques to define the volume of soil to be mobilized. The other method, deterministic, determines the percentage of soil to be mobilized and its spatial distribution. Both cases plot the percentage curves of experimental data related to the soil mechanical resistance to penetration equal or larger to the established critical level and the volume of soil to be mobilized as a function of critical level. The deterministic method plots showed the spatial distribution of the data with resistance to penetration equal or large than the critical level. The comparison between mobilized soil curves as a function of critical level using both methods showed that they can be considered equivalent. The deterministic method has the advantage of showing the spatial distribution of the critical points.

Aerodinâmica de leitos vibrofluidizados: uma revisão

Application of mechanical vibration to aid fluidization and to improve heat, mass and momentum transfer are usual processes in agricultural industry and it has found nowadays extensive applications in particle processing of materials difficult-to-fluidized. Equations and experimental data found in literature for the aerodynamics characteristics of vibro-fluidized beds are presented and discussed, emphasizing the vibration effect in the bed.

Variabilidade espacial de atributos físicos de um argissolo vermelho-amarelo sob pastagem e vegetação secundária em regeneração natural

This work was carried out with the objective of studying the spatial variability of the physical attributes of a Red-Yellow Ultisol under pasture and secondary vegetation in natural regeneration. Two areas were chosen in a hillside, with the soil sampling to the depth of 0-0.2 m, with the georeferenced points in a regular grid of 10x10 m, totalizing 64 points. In each point it was evaluated the total volume of porosity, macroporosity, microporosity, bulk density, soil penetration resistance and soil water content. The studied attributes in the pasture area present indicator of soil compaction for the animals' traffic, with moderate and strong structure of spatial dependence, except for the macroporosity and penetration resistance. In the area of secondary vegetation (VN) only the macroporosity does not present spatial dependence. The total volume of porosity and the bulk density present the same spatial standard in the area under pasture.

Determinação em tempo real da magnitude de danos físicos por impacto em linhas de beneficiamento e em condições de laboratório e seus efeitos na qualidade de tomate

Tomatoes are one of the most important vegetable crops grown in Brazil and are among the crops that have one of the highest post-harvest losses indexes in the country. The present work aimed at evaluating impact damage observed in packing lines of fresh tomatoes as well as to determine, under laboratory conditions, quality alterations of tomato fruits submitted to impact damage in different surface types. Critical points evaluation was accomplished using an instrumented sphere. Critical transference points found showed variations in acceleration levels from 30 to 129 G (m s-2). Tests carried out under laboratory conditions showed that padded surfaces reduced up to 31% impact damage. Incidence of severe internal physical damage was evaluated by a subjective scale and increased by 79% on hard surfaces for the highest fall drop. On the other hand, it was observed an effective reduction in physical damage on fruits when padded surfaces were used. When a 10-cm drop was performed, the maximum reduction measured was 10% for hard surfaces and 5% for previously padded surfaces. For quality parameters, it was observed for high drops on hard surfaces, highest values for weight loss, total acidity, lower values for vitamin C and Soluble Solids.

Avaliação de linhas de beneficiamento e impactos de queda na qualidade de caqui Rama Forte

Excessive and inadequate handling of fruits and vegetables provides high incidences of physical damage, consequently, post harvest losses. The main goal of this work was to evaluate the impact magnitude in persimmon packing lines, Rama Forte, and to determine, at the laboratory, its impact limits. For evaluating the critical points it was used an instrumented sphere of 76 mm of diameter (Technmark, Inc, Lansing, USA), which registered the impact magnitude in seven distinctive impact lines located in four packing houses. For determining physical damages, tests were carried out at the laboratory, where fruit drop was related to impact magnitude, physical damage incidence and fruit post harvest losses. At the packing lines, the values found varied from 21 to 87 G on the transfer points and the majority of registered impacts (over 94%) were down 50G. Drops from 20 cm caused an increase in weight losses after six days of storage at room temperature. Drops from 20 and 30 cm caused skin darkness (low L values), associated to a decrease in color intensity (chroma). Impact drop did not affect pulp fruit chemical features.

Fluidodinâmica de sementes de brócolos em leito fluizado e leito de jorro

The spouted and fluidized bed technologies are usually employed in operations of drying, coating and granulation of particles by the chemical and pharmaceutical industries. The use of these techniques in agronomy is limited to the treatment of some species of seeds. In this work, the objective was to analyse the fluid-dynamics of fluidized and spouted beds when broccoli (Brassica oleracea L. var. Italica) seeds are used and also to verify the influence on seed germination after 60 min of seed exposition to spouting or fluidization, at room temperature. The fluid-dynamics was defined by the measurements of the bed pressure drop as a function of the air flow rate for different seeds loads. The experimental conditions were based on the physical properties of the seeds and were limited by the apparatus dimensions. The cone-cylindrical bed was constructed in plexyglass to permit flow visualization. The values of the parameters: maximum pressure drop, minimum spouting flow rate and pressure drop, and stable spout pressure drop were experimentally obtained from the fluid-dynamic analysis and were compared with the values calculated by empirical equations found in the literature. The same procedure was carried out with the fluidized bed and the important parameters for this regime were the air velocity and the bed pressure drop at minimum fluidization. The analysis of seed germination indicated that no damage was caused to the seeds by the spout or fluidization processes.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Efeitos da constrição pupilar na perimetria de freqüência dupla em olhos normais

Purpose: To study the effects of pupillary constriction on frequency doubling perimetry in a group of normal subjects. Methods: Eighteen healthy volunteers participated in the study. Only one eye per patient (right eye) underwent frequency doubling perimetry (Full Threshold C-20 strategy). For the second session, one drop of 2% pilocarpine was administered to the volunteers' right eye and the examination was repeated after 60 minutes. Results: Sixty minutes after administration of 2% pilocarpine, there was a significant reduction of the pupillary diameter from 4.22 ± 0.17 mm to 1.55 ± 0.51 mm (p<0.05). There was a significant reduction of the mean retinal sensibility after pupillary constriction. The threshold sensitivity of the central 5º worsened by 5.67 ± 2.49 dB; the area between 2.5º and 10º worsened by 4.49 ± 2.73 dB; and the area between 10º and 20º worsened by 5.10 ± 3.55 dB (p<0.01). A reduction of 4.06 ± 2.67 dB was observed in the mean deviation, as well as an increase of 0.64 ± 0.94 dB in the pattern standard deviation (p<0.01). No differences were observed regarding the number of fixation losses, false-positive and false-negatives responses, and duration of the examination. Conclusion: Changes in pupillary diameter may produce significant declines in threshold sensitivities of the 20º visual field tested by frequency doubling perimetry. These results suggest that is important to maintain a constant pupillary diameter in seriate examinations.

Análise dos esforços de alta intensidade de jogadores de futebol profissional

Universidade Estadual de Campinas . Faculdade de Educação Física

O lazer e a residência secundária em Angra dos Reis-RJ = : The leisure and the second homes in Angra dos Reis, RJ

Universidade Estadual de Campinas . Faculdade de Educação Física