10 resultados para Doses of nitrogen
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
346
Resumo:
The present study aimed to investigate the effects of the interaction between the abusive use of nandrolone decanoate (ND) and physical activity on the prostate structure of adult and older rats. We evaluated whether the use of ND, associated or not with physical exercise during the post-pubertal stage, interferes with the morphophysiology of the prostate. Fifty-six male Sprague-Dawley rats were divided into eight groups. The animals were treated for eight weeks and divided into sedentary and trained groups, with or without ND use. Four groups were sacrificed 48 h after the end of the eight week experiment (adult groups), and four other groups were sacrificed at 300 days of age (older groups). The prostate was collected and processed for stereological and histopathological analysis and for the expression of AQP1 and VEGF by the Western blotting technique. Both ND and physical activity altered the ventral prostate structure of the rats; the AQP1 and VEGF expression increased in young animals subjected to physical exercise. Thus, it was concluded that the use of ND, associated or not with exercise during the post-pubertal stage, interferes with the morphophysiology of the prostate.
Resumo:
OBJECTIVE: Evaluate the efficacy of cumulative doses (CDs) of 131I-iodide therapy (RIT) in differentiated thyroid cancer (DTC). SUBJECTS AND METHODS: The probability of progressive disease according to CDs was evaluated in patients < 45 years old and > 45 years old and correlated to tumor-node-metastasis (TNM), thyroglobulin values, histological types and variants, age, and zduration of the disease. RESULTS: At the end of a follow-up period of 69 ± 56 months, 85 out of 150 DTC patients submitted to fixed doses RIT had no evidence of disease, 47 had stable disease and 18 had progressive disease. Higher CDs were used in the more aggressive variants (p < 0.0001), higher TNM stages (p < 0.0001), and follicular carcinomas (p = 0.0034). Probability of disease progression was higher with CDs > 600 mCi in patients > 45 years old and with CDs > 800 mCi in patients < 45 years. CONCLUSION: Although some patients may still respond to high CDs, the impact of further RIT should be carefully evaluated and other treatment strategies may be warranted.
Resumo:
The aim of this study was to evaluate the mutagenicity (clastogenicity/aneugenicity) of a glycolic extract of Ziziphus joazeiro bark (GEZJ) by the micronucleus assay in mice bone marrow. Antimutagenic activity was also assessed using treatments associated with GEZJ and doxorubicin (DXR). Mice were evaluated 24-48 h after exposure to positive (N-nitroso-N-ethylurea, NEU - 50 mg.kg(-1) and DXR - 5 mg.kg(-1)) and negative (150 mM NaCl) controls, as well as treatment with GEZJ (0.5-2 g.kg(-1)), GEZJ (2 g.kg(-1)) + NEU and GEZJ (2 g.kg(-1)) + DXR. There were no significant differences in the frequencies of micronucleated polychromatic erythrocytes in mice treated with GEJZ and GEJZ + DXR compared to the negative controls, indicating that GEZJ was not mutagenic. Analysis of the polychromatic:normochromatic erythrocyte ratio revealed significant differences in the responses to doses of 0.5 g.kg(-1) and 1-2 g.kg(-1) and the positive control (NEU). These results indicated no systemic toxicity and moderate toxicity at lower and higher doses of GEZJ. The lack of mutagenicity and systemic toxicity in the antimutagenic assays, especially for treatment with GEZJ + DXR, suggested that phytochemical compounds in Z. joazeiro bark attenuated DXR-induced mutagenicity and the moderate systemic toxicity of a high dose of Z. joazeiro bark (2 g.kg(-1)). Further studies on the genotoxicity of Z. joazeiro extracts are necessary to establish the possible health risk in humans and to determine the potential as a chemopreventive agent for therapeutic use.
Resumo:
Nitrogen assimilation plays a vital role in plant metabolism. Assimilation of nitrate, the primary source of nitrogen in soil, is linked to the generation of the redox signal nitric oxide (NO). An important mechanism by which NO regulates plant development and stress responses is through S-nitrosylation, that is, covalent attachment of NO to cysteine residues to form S-nitrosothiols (SNO). Despite the importance of nitrogen assimilation and NO signalling, it remains largely unknown how these pathways are interconnected. Here we show that SNO signalling suppresses both nitrate uptake and reduction by transporters and reductases, respectively, to fine tune nitrate homeostasis. Moreover, NO derived from nitrate assimilation suppresses the redox enzyme S-nitrosoglutathione Reductase 1 (GSNOR1) by S-nitrosylation, preventing scavenging of S-nitrosoglutathione, a major cellular bio-reservoir of NO. Hence, our data demonstrates that (S)NO controls its own generation and scavenging by modulating nitrate assimilation and GSNOR1 activity.
Resumo:
Rubus niveus Thunb. plant belongs to Rosaceae family and have been used traditionally to treat wounds, burns, inflammation, dysentery, diarrhea and for curing excessive bleeding during menstrual cycle. The present study was undertaken to investigate the in vivo genotoxicity of Rubus niveus aerial parts extract and its possible chemoprotection on doxorubicin (DXR)-induced DNA damage. In parallel, the main phytochemicals constituents in the extract were determined. The animals were exposed to the extract for 24 and 48h, and the doses selected were 500, 1000 and 2000mg/kg b.w. administered by gavage alone or prior to DXR (30mg/kg b.w.) administered by intraperitoneal injection. The endpoints analyzed were DNA damage in bone marrow and peripheral blood cells assessed by the alkaline alkaline (pH>13) comet assay and bone marrow micronucleus test. The results of chemical analysis of the extract showed the presence of tormentic acid, stigmasterol, quercitinglucoronide (miquelianin) and niga-ichigoside F1 as main compounds. Both cytogenetic endpoints analyzed showed that there were no statistically significant differences (p>0.05) between the negative control and the treated groups with the two higher doses of Rubus niveus extract alone, demonstrating absence of genotoxic and mutagenic effects. Aneugenic/clastogenic effect was observed only at 2000mg/kg dose. On the other hand, in the both assays and all tested doses were observed a significant reduction of DNA damage and chromosomal aberrations in all groups co-treated with DXR and extract compared to those which received only DXR. These results indicate that Rubus niveus aerial parts extract did not revealed any genotoxic effect, but presented some aneugenic/clastogenic effect at higher dose; and suggest that it could be a potential adjuvant against development of second malignant neoplasms caused by the cancer chemotherapic DXR.
Resumo:
Both high-fat diet and exposure to endocrine-disrupting chemicals have been implicated in susceptibility to pathological prostate lesions, but the consequences of combining the two have not yet been examined. We evaluated the effects of gestational and postnatal exposure to a high-fat diet (20% fat) and low doses of di-n-butyl phthalate (DBP; 5mg/kg/day), individually or in combination, on the tissue response and incidence of pathological lesions in the ventral prostate of adult gerbils. Continuous intake of a high-fat diet caused dyslipidemia, hypertrophy, and promoted the development of inflammatory, premalignant and malignant prostate lesions, even in the absence of obesity. Life-time DBP exposure was obesogenic and dyslipidemic and increased the incidence of premalignant prostate lesions. Combined exposure to DBP and a high-fat diet also caused prostate hypertrophy, but the effects were less severe than those of individual treatments; combined exposure neither induced an inflammatory response nor altered serum lipid content.
Resumo:
Recently, to obtain lipids from microalgae has been the object of extensive research, since it is viewed as a promising feedstock for biodiesel production, especially when compared with crops such as soybean and sunflower, in terms of theoretical performance. The reduction of nutrient availability in culture media, especially nitrogen, stresses the microorganisms and affects cell growth, thus inducing lipid accumulation. This is an interesting step in biodiesel feedstock obtention from microalgae and should be better understood. In this study, four levels of nitrogen concentration in the BG-11 culture medium were evaluated in the growth of the chlorophycean microalga Desmodesmus sp. Both cell growth and lipid content were monitored over 7 days of cultivation, which yielded a final cell density of 33 × 10(6) cells mL(-1) with an initial NaNO3 concentration of 750 mg L(-1) in the medium and a maximum lipid content of 23 % with total nitrogen starvation. It was observed that the microalgae presented high lipid accumulation in the fourth day of cultivation with nitrogen starvation, although with moderate cell growth.
Resumo:
The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.