12 resultados para Domain-specific analysis

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

80.00% 80.00%

Publicador:

Resumo:

The androgen insensitivity syndrome (AIS) is described as a dysfunction of the androgen receptor (AR) in 46,XY individuals, which can be associated with mutations in the AR gene or can be due to unknown mechanisms. Different mutations in AIS generally cause variable phenotypes that range from a complete hormone resistance to a mild form usually associated with male infertility. The purpose of this study was to search for mutations in the AR gene in a fertile man with gynecomastia and to evaluate the influence of the mutation on the AR transactivation ability. Sequencing of the AR gene revealed the p.Pro695Ser mutation. It is located within the AR ligand-binding domain. Bioinformatics analysis indicated a deleterious role, which was verified after testing transactivation activity and N-/C-terminal (N/C) interaction by in vitro expression of a reporter gene and 2-hybrid assays. p.Pro695Ser showed low levels of both transactivation activity and N/C interaction at low dihydrotestosterone (DHT) conditions. As the ligand concentration increased, both transactivation activity and N/C interaction also increased and reached normal levels. Therefore, this study provides functional insights for the p.Pro695Ser mutation described here for the first time in a patient with mild AIS. The expression profile of p.Pro695Ser not only correlates to the patient's phenotype, but also suggests that a high-dose DHT therapy may overcome the functional deficit of the mutant AR.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

This study aimed to identify novel biomarkers for thyroid carcinoma diagnosis and prognosis. We have constructed a human single-chain variable fragment (scFv) antibody library that was selected against tumour thyroid cells using the BRASIL method (biopanning and rapid analysis of selective interactive ligands) and phage display technology. One highly reactive clone, scFv-C1, with specific binding to papillary thyroid tumour proteins was confirmed by ELISA, which was further tested against a tissue microarray that comprised of 229 thyroid tissues, including: 110 carcinomas (38 papillary thyroid carcinomas (PTCs), 42 follicular carcinomas, 30 follicular variants of PTC), 18 normal thyroid tissues, 49 nodular goitres (NG) and 52 follicular adenomas. The scFv-C1 was able to distinguish carcinomas from benign lesions (P=0.0001) and reacted preferentially against T1 and T2 tumour stages (P=0.0108). We have further identified an OTU domain-containing protein 1, DUBA-7 deubiquitinating enzyme as the scFv-binding antigen using two-dimensional polyacrylamide gel electrophoresis and mass spectrometry. The strategy of screening and identifying a cell-surface-binding antibody against thyroid tissues was highly effective and resulted in a useful biomarker that recognises malignancy among thyroid nodules and may help identify lower-risk cases that can benefit from less-aggressive management.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The new social panorama resulting from aging of the Brazilian population is leading to significant transformations within healthcare. Through the cluster analysis strategy, it was sought to describe the specific care demands of the elderly population, using frailty components. Cross-sectional study based on reviewing medical records, conducted in the geriatric outpatient clinic, Hospital de Clínicas, Universidade Estadual de Campinas (Unicamp). Ninety-eight elderly users of this clinic were evaluated using cluster analysis and instruments for assessing their overall geriatric status and frailty characteristics. The variables that most strongly influenced the formation of clusters were age, functional capacities, cognitive capacity, presence of comorbidities and number of medications used. Three main groups of elderly people could be identified: one with good cognitive and functional performance but with high prevalence of comorbidities (mean age 77.9 years, cognitive impairment in 28.6% and mean of 7.4 comorbidities); a second with more advanced age, greater cognitive impairment and greater dependence (mean age 88.5 years old, cognitive impairment in 84.6% and mean of 7.1 comorbidities); and a third younger group with poor cognitive performance and greater number of comorbidities but functionally independent (mean age 78.5 years old, cognitive impairment in 89.6% and mean of 7.4 comorbidities). These data characterize the profile of this population and can be used as the basis for developing efficient strategies aimed at diminishing functional dependence, poor self-rated health and impaired quality of life.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Human Neks are a conserved protein kinase family related to cell cycle progression and cell division and are considered potential drug targets for the treatment of cancer and other pathologies. We screened the activation loop mutant kinases hNek1 and hNek2, wild-type hNek7, and five hNek6 variants in different activation/phosphorylation statesand compared them against 85 compounds using thermal shift denaturation. We identified three compounds with significant Tm shifts: JNK Inhibitor II for hNek1(Δ262-1258)-(T162A), Isogranulatimide for hNek6(S206A), andGSK-3 Inhibitor XIII for hNek7wt. Each one of these compounds was also validated by reducing the kinases activity by at least 25%. The binding sites for these compounds were identified by in silico docking at the ATP-binding site of the respective hNeks. Potential inhibitors were first screened by thermal shift assays, had their efficiency tested by a kinase assay, and were finally analyzed by molecular docking. Our findings corroborate the idea of ATP-competitive inhibition for hNek1 and hNek6 and suggest a novel non-competitive inhibition for hNek7 in regard to GSK-3 Inhibitor XIII. Our results demonstrate that our approach is useful for finding promising general and specific hNekscandidate inhibitors, which may also function as scaffolds to design more potent and selective inhibitors.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física