12 resultados para DONOR-SPECIFIC ANTIBODIES

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

80.00% 80.00%

Publicador:

Resumo:

Basic phospholipases A2 (PLA2) are toxic and induce a wide spectrum of pharmacological effects, although the acidic enzyme types are not lethal or cause low lethality. Therefore, it is challenging to elucidate the mechanism of action of acidic phospholipases. This study used the acidic non-toxic Ba SpII RP4 PLA2 from Bothrops alternatus as an antigen to develop anti-PLA2 IgG antibodies in rabbits and used in vivo assays to examine the changes in crude venom when pre-incubated with these antibodies. Using Ouchterlony and western blot analyses on B. alternatus venom, we examined the specificity and sensitivity of phospholipase A2 recognition by the specific antibodies (anti-PLA2 IgG). Neutralisation assays using a non-toxic PLA2 antigen revealed unexpected results. The (indirect) haemolytic activity of whole venom was completely inhibited, and all catalytically active phospholipases A2 were blocked. Myotoxicity and lethality were reduced when the crude venom was pre-incubated with anti-PLA2 immunoglobulins. CK levels in the skeletal muscle were significantly reduced at 6 h, and the muscular damage was more significant at this time-point compared to 3 and 12 h. When four times the LD50 was used (224 μg), half the animals treated with the venom-anti PLA2 IgG mixture survived after 48 h. All assays performed with the specific antibodies revealed that Ba SpII RP4 PLA2 had a synergistic effect on whole-venom toxicity. IgG antibodies against the venom of the Argentinean species B. alternatus represent a valuable tool for elucidation of the roles of acidic PLA2 that appear to have purely digestive roles and for further studies on immunotherapy and snake envenoming in affected areas in Argentina and Brazil.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Bartonella species are blood-borne, re-emerging organisms, capable of causing prolonged infection with diverse disease manifestations, from asymptomatic bacteremia to chronic debilitating disease and death. This pathogen can survive for over a month in stored blood. However, its prevalence among blood donors is unknown, and screening of blood supplies for this pathogen is not routinely performed. We investigated Bartonella spp. prevalence in 500 blood donors from Campinas, Brazil, based on a cross-sectional design. Blood samples were inoculated into an enrichment liquid growth medium and sub-inoculated onto blood agar. Liquid culture samples and Gram-negative isolates were tested using a genus specific ITS PCR with amplicons sequenced for species identification. Bartonella henselae and Bartonella quintana antibodies were assayed by indirect immunofluorescence. B. henselae was isolated from six donors (1.2%). Sixteen donors (3.2%) were Bartonella-PCR positive after culture in liquid or on solid media, with 15 donors infected with B. henselae and one donor infected with Bartonella clarridgeiae. Antibodies against B. henselae or B. quintana were found in 16% and 32% of 500 blood donors, respectively. Serology was not associated with infection, with only three of 16 Bartonella-infected subjects seropositive for B. henselae or B. quintana. Bartonella DNA was present in the bloodstream of approximately one out of 30 donors from a major blood bank in South America. Negative serology does not rule out Bartonella spp. infection in healthy subjects. Using a combination of liquid and solid cultures, PCR, and DNA sequencing, this study documents for the first time that Bartonella spp. bacteremia occurs in asymptomatic blood donors. Our findings support further evaluation of Bartonella spp. transmission which can occur through blood transfusions.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The development of inhibitory antibodies against factor VIII (FVIII) (inhibitor) is the major complication in haemophilia A patients. The FVIII-binding antibodies development comprises a polyclonal immunoglobulin (Ig) G response. Recent studies showed strong correlation between the presence of neutralizing anti-FVIII antibodies (inhibitors) and IgG4 subclass. The aim of this study was to evaluate anti-FVIII IgG subclasses in haemophilia A patients with inhibitor both in a cross-sectional and in a longitudinal analysis. Inhibitors were determined by Nijmegen-Bethesda assay. Anti-FVIII IgG subclasses were performed by ELISA, and samples from 20 healthy individuals were used to validate the test. We studied 25 haemophilia A patients with inhibitor, previously treated exclusively with plasma-derived FVIII concentrates or bypassing agents. The IgG subclasses distributions were evaluated in two groups of patients classified according to inhibitor response. IgG1 and IgG4 antibodies were most prominent in haemophilia A patients with inhibitors when compared with IgG2 and IgG3. This study reports for the first time the behaviour of FVIII-binding IgG1 and IgG4 subclasses in a longitudinal analysis, in a clinical setting, of high-response inhibitor haemophilia A patients, showing the correlation of IgG4 and the inhibitor titres. In spite of being considered a non-pathologic antibody subclass with anti-inflammatory properties in other situations, IgG4 is correlated with the presence of high-titre inhibitor in the haemophilia setting. The comprehension of the IgG4 role in immune response may be crucial to establish the process for designing specific tolerance to FVIII.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to identify novel biomarkers for thyroid carcinoma diagnosis and prognosis. We have constructed a human single-chain variable fragment (scFv) antibody library that was selected against tumour thyroid cells using the BRASIL method (biopanning and rapid analysis of selective interactive ligands) and phage display technology. One highly reactive clone, scFv-C1, with specific binding to papillary thyroid tumour proteins was confirmed by ELISA, which was further tested against a tissue microarray that comprised of 229 thyroid tissues, including: 110 carcinomas (38 papillary thyroid carcinomas (PTCs), 42 follicular carcinomas, 30 follicular variants of PTC), 18 normal thyroid tissues, 49 nodular goitres (NG) and 52 follicular adenomas. The scFv-C1 was able to distinguish carcinomas from benign lesions (P=0.0001) and reacted preferentially against T1 and T2 tumour stages (P=0.0108). We have further identified an OTU domain-containing protein 1, DUBA-7 deubiquitinating enzyme as the scFv-binding antigen using two-dimensional polyacrylamide gel electrophoresis and mass spectrometry. The strategy of screening and identifying a cell-surface-binding antibody against thyroid tissues was highly effective and resulted in a useful biomarker that recognises malignancy among thyroid nodules and may help identify lower-risk cases that can benefit from less-aggressive management.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Herpesvirus reactivation is common after liver transplantation. Analyze the presence of cytomegalovirus (HCMV) and human herpesvirus-6 (HHV-6) DNA in liver donor biopsies, seeking to better understand issues involving human donor leukocyte antigens (HLA)-A, B and DR, as well as correlations with acute cellular rejection. Fifty-nine liver transplantation patients were investigated for the presence of HCMV and HHV-6 DNA in liver donor biopsies, using the Nested-PCR technique. The clinical donor information and HLA matches were obtained from the São Paulo State Transplant System. The recipients' records regarding acute cellular rejection were studied. Seven (11.8%) biopsies were positive for HCMV DNA and 29 (49%) were positive for HHV-6 DNA. In 14 donors with HLA-DR 15 nine had HHV-6 DNA positive liver biopsy with a tendency for significant association (p=0.09), 22 recipients developed acute cellular rejection and 9/22 were positive for HLA-DR 15 (p=0.03; χ(2)=4.51), which was statistically significant in univariate analysis and showed a tendency after multivariate analysis (p=0.08). HHV-6 DNA was prevalent in liver donors studied as well as HLA-DR 15. These findings suggest that patients with HLA-DR 15 in liver donor biopsies develop more rejection after liver transplantation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Human exposure to Bartonella clarridgeiae has been reported only on the basis of antibody detection. We report for the first time an asymptomatic human blood donor infected with B. clarridgeiae, as documented by enrichment blood culture, PCR, and DNA sequencing.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this paper is the description of the strategies and advances in the use of MIP in the development of chemical sensors. MIP has been considered an emerging technology, which allows the synthesis of materials that can mimic some highly specific natural receptors such as antibodies and enzymes. In recent years a great number of publications have demonstrated a growth in their use as sensing phases in the construction of sensors . Thus, the MIP technology became very attractive as a promising analytical tool for the development of sensors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Immobilized Metal Ion Affinity Cromatography - IMAC - is a group-specific based adsorption applied to the purification and structure-function studies of proteins and nucleic acids. The adsorption is based on coordination between a metal ion chelated on the surface of a solid matrix and electron donor groups at the surface of the biomolecule. IMAC is a highly selective, low cost, and easily scaled-up technique being used in research and commercial operations. A separation process can be designed for a specific molecule by just selecting an appropriate metal ion, chelating agent, and operational conditions such as pH, ionic strength, and buffer type.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.