13 resultados para Current events
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Cardiac arrhythmias are one of the main causes of death worldwide. Several studies have shown that inflammation plays a key role in different cardiac diseases and Toll-like receptors (TLRs) seem to be involved in cardiac complications. In the present study, we investigated whether the activation of TLR4 induces cardiac electrical remodeling and arrhythmias, and the signaling pathway involved in these effects. Membrane potential was recorded in Wistar rat ventricle. Ca(2+) transients, as well as the L-type Ca(2+) current (ICaL) and the transient outward K(+) current (Ito), were recorded in isolated myocytes after 24 h exposure to the TLR4 agonist, lipopolysaccharide (LPS, 1 μg/ml). TLR4 stimulation in vitro promoted a cardiac electrical remodeling that leads to action potential prolongation associated with arrhythmic events, such as delayed afterdepolarization and triggered activity. After 24 h LPS incubation, Ito amplitude, as well as Kv4.3 and KChIP2 mRNA levels were reduced. The Ito decrease by LPS was prevented by inhibition of interferon regulatory factor 3 (IRF3), but not by inhibition of interleukin-1 receptor-associated kinase 4 (IRAK4) or nuclear factor kappa B (NF-κB). Extrasystolic activity was present in 25% of the cells, but apart from that, Ca(2+) transients and ICaL were not affected by LPS; however, Na(+)/Ca(2+) exchanger (NCX) activity was apparently increased. We conclude that TLR4 activation decreased Ito, which increased AP duration via a MyD88-independent, IRF3-dependent pathway. The longer action potential, associated with enhanced Ca(2+) efflux via NCX, could explain the presence of arrhythmias in the LPS group.
Resumo:
80
Resumo:
30 Suppl 1
Resumo:
Reduction in sirtuin 1 (Sirt-1) is associated with extracellular matrix (ECM) accumulation in the diabetic kidney. Theobromine may reduce kidney ECM accumulation in diabetic rats. In the current study, we aimed to unravel, under diabetic conditions, the mechanism of kidney ECM accumulation induced by a reduction in Sirt-1 and the effect of theobromine in these events. In vitro, we used immortalized human mesangial cells (iHMCs) exposed to high glucose (HG; 30 mM), with or without small interfering RNA for NOX4 and Sirt-1. In vivo, spontaneously hypertensive rats (SHR) were rendered diabetic by means of streptozotocin and studied after 12 wk. The effects of treatment with theobromine were investigated under both conditions. HG leads to a decrease in Sirt-1 activity and NAD(+) levels in iHMCs. Sirt-1 activity could be reestablished by treatment with NAD(+), silencing NOX4, and poly (ADP-ribose) polymerase-1 (PARP-1) blockade, or with theobromine. HG also leads to a low AMP/ATP ratio, acetylation of SMAD3, and increased collagen IV, which is prevented by theobromine. Sirt-1 or AMPK blockade abolished these effects of theobromine. In diabetic SHR, theobromine prevented increases in albuminuria and kidney collagen IV, reduced AMPK, elevated NADPH oxidase activity and PARP-1, and reduced NAD(+) levels and Sirt-1 activity. These results suggest that in diabetes mellitus, Sirt-1 activity is reduced by PARP-1 activation and NAD(+) depletion due to low AMPK, which increases NOX4 expression, leading to ECM accumulation mediated by transforming growth factor (TGF)-β1 signaling. It is suggested that Sirt-1 activation by theobromine may have therapeutic potential for diabetic nephropathy.
Resumo:
High-speed counter-current chromatography (HSCCC) is a major tool for the fast separation of natural products from plants. It was used for the preparative isolation of the flavonoid monoglucosides present in the aerial parts of the Davilla elliptica St. Hill. (Dilleniaceae). This species is used in Brazilian folk medicine for the treatment of gastric disorders. The optimum solvent system used was composed of a mixture of ethyl acetate-n-propanol-water (140:8:80, v/v/v) and led to a successful separation of quercetin-3-O-alpha-L-rhamnopyranoside and myricetin-3-O-alpha-L-rhamnopyranoside in approximately 3.0 hours with purity higher than 95%. Identification was performed by ¹H NMR, 13C NMR and HPLC-UV-DAD analyses.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física