Desenvolvimento e validação de método espectrofotométrico para determinação de corante à base de luteína adicionado em iogurte desnatado

A simple analytical method for extraction and quantification of lutein colorant added to yogurt was developed and validated. The method allowed complete extraction of carotenoids using tetrahydrofuran in vortex, followed by centrifugation, partition to diethyl ether/petroleum ether, and drying. The carotenoids dissolved in ethanol were quantified by UV-Vis spectrophotometry. This method showed linearity in the range tested (1.41-13.42 µg g-1), limits of detection and quantification of 0.42 and 1.28 µg g-1, respectively, low relative standard deviation (3.4%) and recovery ranging from 95 to 103%. The method proved reliable for quantification of lutein added to yogurt.

Rugosidade e pigmentação superficial de materiais ionoméricos

The aim of this study was to compare two methods of surface roughness analysis, perfilometry and spectrophotometry, applied to the surface of ionomeric materials (Chelon Fil, Vitremer and Dyract), submitted to different surface finishing treatments. For the perfilometric analysis, sixty specimens of each material were made and randomly separated into three experimental groups. The average surface roughness (Ra, mm) was measured on each specimen by a surface perfilometer (Mitutoyo Surftest 211). The spectrophotometric analysis consisted in quantifying the dye impregnated in the samples. The dyes used were 0.5% fuchsin and 0.5% erythrosin. Data were submitted to variance analysis (ANOVA) and t-Student test at a 0.05 significance level. There was no linear correlation between average roughness and superficial deposition of dye. Perfilometric analysis revealed that 12- and 30-bladed carbide burs caused the roughest surface of Chelon Fil, followed by Sof-Lex discs and mylar band. There were no significant differences between the specimens submitted to finishing and polishing with Sof-Lex discs and the control group (mylar band) for Vitremer, nevertheless, the highest Ra values were obtained when 12- and 30-bladed burs were used. For Dyract, there was no significant difference between the three treatments. The mean values of superficial deposition of dye for Chelon Fil, Vitremer and Dyract were: 1.7261, 1.4759, 1.3318, respectively. There were no significant differences between the restorative materials when different finishing and polishing systems were used.

CROMATOGRAFIA DE AFINIDADE COM CORANTE RED A versus TROCA IÔNICA-PERMEABILIDADE EM GEL: COMPARAÇÃO DA PRATICIDADE NA PURIFICAÇÃO DE ENTEROTOXINA ESTAFILOCÓCICA A

Culture supernatant of Staphylococcus aureus 722 in 3% triptone plus 1% yeast extract was used for EEA purification, proceeding comparison between dye ligand Red A affinity chromatography and classic chromatography. The capture of SEA with Amberlite CG-50 allowed rapid enterotoxin concentration from the culture supernatant. However, the ratio of 15 mg of the resin to a total of 150 mg of the toxin satured the resin, giving only 10 to 30% of SEA recuperation from the supernatant. The elution of concentrated material throught the Red A column resulted in a recovery of 60,87% of the toxin, and required 76 hours, indicating advantage on classic chromatography. Ion exchange column plus gel filtration recovered only 6,5 % of the SEA, and required 114 hours to conclude the procedure. The eletrophoresis of purified SEA indicated high grade of toxin obtained from Red A column, with 90 % of purity, compared to 60 % of classic column.

Análise de custo-efetividade de métodos preventivos para superfície oclusal de acordo com o risco de cárie: resultados de um ensaio clínico controlado

This study presents the results of a cost-effectiveness analysis in a controlled clinical trial on the effectiveness of a modified glass ionomer resin sealant ( Vitremer, 3M ESPE) and the application of fluoride varnish (Duraphat, Colgate) on occlusal surfaces of first permanent molars in children 6-8 years of age (N = 268), according to caries risk (high versus low). Children were examined semiannually by the same calibrated dentist for 24 months after allocation in six groups: high and low risk controls (oral health education every three months); high and low risk with varnish (oral health education every three months + varnish biannually); and high and low risk with sealant (oral health education every three months + a single application of sealant). Economic analysis showed that sealing permanent first molars of high-risk schoolchildren showed a C/E ratio of US$ 119.80 per saved occlusal surface and an incremental C/E ratio of US$ 108.36 per additional saved occlusal surface. The study concluded that sealing permanent first molars of high-risk schoolchildren was the most cost-effective intervention.

Efeito cariostático de restaurações adesivas em superfícies radiculares: estudo in vitro

Dental materials that release fluoride have been shown to be effective in caries inhibition around restorations. Adhesive materials would also be effective in caries inhibition by sealing and protecting cavity margins from acidic demineralization. This in vitro study tested the hypothesis that composite restorations with a dentin adhesive system have a caries preventive effect similar to that of an adhesive material with fluoride - glass-ionomer cement - on root surfaces. Twenty roots from extracted sound third molars were embedded in polystyrene resin and ground flat. Standardized cavities were prepared in leveled root surfaces and randomly restored with (a) Chelon-Fil (Espe) or (b) Z100/SingleBond (3M). Baseline indentations were measured at 100, 200 and 300 mum from the occlusal margins of each restoration and the surface microhardness values were obtained using a Knoop diamond indenter. A 2.0 mm wide margin around the restorations was submitted to a pH-cycling model, at 37ºC. After that, surface microhardness was measured again, as it was before. The differences between baseline and final surface microhardness were considered for statistical analysis. The median values of differences were (a): -3.8; -0.3; -1.0; and (b): 3.3; 2.5; 1.7, for the distances of 100, 200 and 300 mum, respectively. The Kruskal-Wallis test did not show statistically significant difference between 100, 200 and 300 mum distances in each tested group. There was no difference between the studied materials at the distances of 200 and 300 mum. Chelon-Fil was statistically different from Z100/SingleBond, at 100 mum (p<0.05). Under the studied conditions, the glass-ionomer cement had a higher caries preventive effect than the composite/dentin adhesive restorations.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.