14 resultados para Cooperação Técnica Internacional
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Usually, the concepts of the Sol-Gel technique are not applied in experimental chemistry courses. This work presents a feasible experiment for chemistry instruction, which involves the synthesis of luminescent materials - Zn2SiO4, with and without Mn2+ as a dopant - by the Sol-Gel technique. The obtained materials were analyzed by scanning electron microscopy, X-Ray diffraction, IR spectroscopy and luminescence measures by UV-vis spectroscopy. The results allow the students to confirm the luminescent properties of the zinc orthosilicate luminophores as well as the structural features expected from literature data.
Resumo:
The MINUS system was developed as a minimally invasive procedure that uses a diaphyseal cephalic extramedullary implant for the treatment of transtrochanteral fractures of the femur in elderly patients. The implant consists of a sliding screw coupled to a plate adapted to the minimally invasive technique. The surgical access is approximately three centimeters in length located on the lateral surface of the hip, below the projection of the small trochanter. A perfectly adapted instrument was used for the procedure, which also requires the use of an image intensifier, reducing surgery time and rate of bleeding. The objective of this study is to present a new instrument and implant, developed specifically for treatment with the minimally invasive technique, reducing the length of the conventional surgical access from 10 to three centimetres. This new implant was given the commercial name of MINUS System.
Resumo:
The acceptability of nine commercial brazilian varietal white table wines (Riesling, Chardonnay and Gewürztraminer) was evaluated using sensory affective tests. The samples were assessed by 43 consumers of brazilian white wines using he nine-point structured hedonic scale. Judges were recruited based on their responses to a questionnary about consumer?s behavior towards white wines consumption. Subsequently, Analysis of Variance (ANOVA) with means comparision (Tukey test) and Internal Analysis of Preference Mapping (MDPREF) were performed on data. Analysis of Variance showed that two samples (a Riesling and a Gewürztraminer, both sweet table wines) had significantly (p < 0.05) higher acceptance means, around 7 in the hedonic scale. The least acceptance means (4,3) was obtained by a demi-sec Chardonnay wine and the other six samples achieved means around 5 in the hedonic scale, all of them either demi-sec or dry table wines. MDPREF confirmed the results showed by ANOVA showing that samples were segmented into two groups of preference. The first group was composed by 86% of consumers who prefered the sweet table wines (higher acceptance), converging to the region on the map where these samples were represented. Only 14% showed preference for the demi-sec and dry table wines, being represented on the region of the MDPREF where these samples were located. This study suggests that sweet table wines are prefered by Brazilian consumers, instead of dry or demi-sec table wines.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física