13 resultados para Controle de infecção urinária

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Acute disseminated encephalomyelitis (ADEM) is a widespread monophasic inflamatory disease affecting the central nervous system, that usually follows an infection or vaccination. In this study, we present an analysis of magnetic resonance imaging (MRI), cerebrospinal fluid (CSF) and clinical aspects in four patients with clinical diagnosis of ADEM. The presence of MRI demyelinating lesions was crucial, but not in itself sufficient for definitive diagnosis. Clinical and MRI follow up, in order to exclude new lesions and to reevaluate the former ones, as well as CSF, were important for the differential diagnosis with other demyelinating diseases, particularly multiple sclerosis. In addition, we have shown that early treatment with methylprednisolone after the initial symptoms was effective for improving clinical manifestations as well as for reducing MRI lesions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The individual affective-cognitive evaluations are important factors that control the way he feels the disease impact in his life. Then, the perception of seizure control is a more important factor to evaluate Quality of Life (QoL) than the illness characteristics, such as the severity, type, sickening period and seizure frequency. This study searched for the relationship among the subjective variables (perception of seizure control) and the illness characteristics to evaluate QoL. The sample consisted of 60 individuals with chronic epilepsy, aging 18 to 70 (M=37.05; SD=11.25), chosen at randon from the ambulatory of epilepsy - HC/UNICAMP, by the Questionnaire 65. The illness characteristics were not significant, except the seizures frequency, when associated to the impairment in QoL among controlled seizures and seizures with frequency higher than 10 per month (p=0.021). The perception of control was significantly associated to QoL (p=0.005).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to test fear, anxiety and control related to dental treatment. The subjects were 364 children with ages between 7 and 13 years. Three questionnaires with multiple choice questions were applied in groups of 10 children. The first instrument was the 15-item dental subscale from the Children’s Fear Survey Schedule9. The subjects rated their level of fear on a 5-point scale. The second survey instrument was the 20-item subscale from the State Trait Anxiety Inventory for Children16. This measure was used to capture how anxious the child was, in general. The third instrument was the Child Dental Control Assessment19. It contained 20 items to assess perceived control and 20 items to assess desired control. The results of the survey indicated that dental fear and anxiety were slightly higher for females when compared with male subjects (P < 0.05). Older children (11 to 13 years old) obtained higher fear scores than younger ones (7 to 9 years old). Concerning perceived control, the results indicate that younger children perceive more control than older ones. For desired control, the results indicate that younger children reported higher percentages than older ones. In this study, patients who had undergone anesthesia during treatment revealed higher fear scores when compared with those who had not. Dental fear etiology seems to be related to a procedure that may involve pain or lack of control.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física