21 resultados para Control agent
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The aim of this study was to evaluate the effectiveness of 17% ethylene-diamine-tetra-acetic acid (EDTA) used alone or associated with 2% chlorhexidine gel (CHX) on intracanal medications (ICM) removal. Sixty single-rooted human teeth with fully formed apex were selected. The cervical and middle thirds of each canal were prepared with Gates Glidden drills and rotary files. The apical third was shaped with hand files. The specimens were randomly divided into two groups depending on the ICM used after instrumentation: calcium hydroxide Ca(OH)(2) +CHX or Ca(OH)(2) +sterile saline (SS). After seven days, each group was divided into subgroups according to the protocol used for ICM removal: instrumentation and irrigation either with EDTA, CHX+EDTA, or SS (control groups). All specimens were sectioned and processed for observation of the apical thirds by using scanning electron microscopy. Two calibrated evaluators attributed scores to each specimen. The differences between the protocols for ICM removal were analyzed with Kruskal-Wallis and Mann-Whitney U tests. Friedman and Wilcoxon signed rank tests were used for comparison between the score of debris obtained in each root canal third. Remains of Ca(OH)(2) were found in all specimens independently of the protocol and ICM used (P > 0.05). Seventeen percent EDTA showed the best results in removing ICM when used alone (P < 0.05), particularly in those associated with CHX. It was concluded that the chelating agent 17% EDTA significantly improved the removal of ICM when used alone. Furthermore, the type of the vehicle associated with Ca(OH)(2) also plays a role in the ICM removal.
Resumo:
The control of energy homeostasis relies on robust neuronal circuits that regulate food intake and energy expenditure. Although the physiology of these circuits is well understood, the molecular and cellular response of this program to chronic diseases is still largely unclear. Hypothalamic inflammation has emerged as a major driver of energy homeostasis dysfunction in both obesity and anorexia. Importantly, this inflammation disrupts the action of metabolic signals promoting anabolism or supporting catabolism. In this review, we address the evidence that favors hypothalamic inflammation as a factor that resets energy homeostasis in pathological states.
Resumo:
Paraquat is a fast acting nonselective contact herbicide that is extensively used worldwide. However, the aqueous solubility and soil sorption of this compound can cause problems of toxicity in nontarget organisms. This work investigates the preparation and characterization of nanoparticles composed of chitosan and sodium tripolyphosphate (TPP) to produce an efficient herbicidal formulation that was less toxic and could be used for safer control of weeds in agriculture. The toxicities of the formulations were evaluated using cell culture viability assays and the Allium cepa chromosome aberration test. The herbicidal activity was investigated in cultivations of maize (Zea mays) and mustard (Brassica sp.), and soil sorption of the nanoencapsulated herbicide was measured. The efficiency association of paraquat with the nanoparticles was 62.6 ± 0.7%. Encapsulation of the herbicide resulted in changes in its diffusion and release as well as its sorption by soil. Cytotoxicity and genotoxicity assays showed that the nanoencapsulated herbicide was less toxic than the pure compound, indicating its potential to control weeds while at the same time reducing environmental impacts. Measurements of herbicidal activity showed that the effectiveness of paraquat was preserved after encapsulation. It was concluded that the encapsulation of paraquat in nanoparticles can provide a useful means of reducing adverse impacts on human health and the environment, and that the formulation therefore has potential for use in agriculture.
Resumo:
The maintenance of glucose homeostasis is complex and involves, besides the secretion and action of insulin and glucagon, a hormonal and neural mechanism, regulating the rate of gastric emptying. This mechanism depends on extrinsic and intrinsic factors. Glucagon-like peptide-1 secretion regulates the speed of gastric emptying, contributing to the control of postprandial glycemia. The pharmacodynamic characteristics of various agents of this class can explain the effects more relevant in fasting or postprandial glucose, and can thus guide the individualized treatment, according to the clinical and pathophysiological features of each patient.
Resumo:
The aim of this study was to evaluate the mutagenicity (clastogenicity/aneugenicity) of a glycolic extract of Ziziphus joazeiro bark (GEZJ) by the micronucleus assay in mice bone marrow. Antimutagenic activity was also assessed using treatments associated with GEZJ and doxorubicin (DXR). Mice were evaluated 24-48 h after exposure to positive (N-nitroso-N-ethylurea, NEU - 50 mg.kg(-1) and DXR - 5 mg.kg(-1)) and negative (150 mM NaCl) controls, as well as treatment with GEZJ (0.5-2 g.kg(-1)), GEZJ (2 g.kg(-1)) + NEU and GEZJ (2 g.kg(-1)) + DXR. There were no significant differences in the frequencies of micronucleated polychromatic erythrocytes in mice treated with GEJZ and GEJZ + DXR compared to the negative controls, indicating that GEZJ was not mutagenic. Analysis of the polychromatic:normochromatic erythrocyte ratio revealed significant differences in the responses to doses of 0.5 g.kg(-1) and 1-2 g.kg(-1) and the positive control (NEU). These results indicated no systemic toxicity and moderate toxicity at lower and higher doses of GEZJ. The lack of mutagenicity and systemic toxicity in the antimutagenic assays, especially for treatment with GEZJ + DXR, suggested that phytochemical compounds in Z. joazeiro bark attenuated DXR-induced mutagenicity and the moderate systemic toxicity of a high dose of Z. joazeiro bark (2 g.kg(-1)). Further studies on the genotoxicity of Z. joazeiro extracts are necessary to establish the possible health risk in humans and to determine the potential as a chemopreventive agent for therapeutic use.
Resumo:
The objective of this study was to analyze the prevalence of diabetes in older people and the adopted control measures. Data regarding older diabetic individuals who participated in the Health Surveys conducted in the Municipality of Sao Paulo, SP, ISA-Capital, in 2003 and 2008, which were cross-sectional studies, were analyzed. Prevalences and confidence intervals were compared between 2003 and 2008, according to sociodemographic variables. The combination of the databases was performed when the confidence intervals overlapped. The Chi-square (level of significance of 5%) and the Pearson's Chi-square (Rao-Scott) tests were performed. The variables without overlap between the confidence intervals were not tested. The age of the older adults was 60-69 years. The majority were women, Caucasian, with an income of between > 0.5 and 2.5 times the minimum salary and low levels of schooling. The prevalence of diabetes was 17.6% (95%CI 14.9;20.6) in 2003 and 20.1% (95%CI 17.3;23.1) in 2008, which indicates a growth over this period (p at the limit of significance). The most prevalent measure adopted by the older adults to control diabetes was hypoglycemic agents, followed by diet. Physical activity was not frequent, despite the significant differences observed between 2003 and 2008 results. The use of public health services to control diabetes was significantly higher in older individuals with lower income and lower levels of education. Diabetes is a complex and challenging disease for patients and the health systems. Measures that encourage health promotion practices are necessary because they presented a smaller proportion than the use of hypoglycemic agents. Public health policies should be implemented, and aimed mainly at older individuals with low income and schooling levels. These changes are essential to improve the health condition of older diabetic patients.
Resumo:
A retrospective case-control study based on craniometrical evaluation was performed to evaluate the incidence of basilar invagination (BI). Patients with symptomatic tonsillar herniation treated surgically had craniometrical parameters evaluated based on CT scan reconstructions before surgery. BI was diagnosed when the tip of the odontoid trespassed the Chamberlain's line in three different thresholds found in the literature: 2, 5 or 6.6 mm. In the surgical group (SU), the mean distance of the tip of the odontoid process above the Chamberlain's line was 12 mm versus 1.2 mm in the control (CO) group (p<0.0001). The number of patients with BI according to the threshold used (2, 5 or 6.6 mm) in the SU group was respectively 19 (95%), 16 (80%) and 15 (75%) and in the CO group it was 15 (37%), 4 (10%) and 2 (5%).
Resumo:
83
Resumo:
This work addresses the development and characterization of porous chitosan-alginate based polyelectrolyte complexes, obtained by using two different proportions of the biocompatible surfactant Pluronic F68. These biomaterials are proposed for applications as biodegradable and biocompatible wound dressing and/or scaffolds. The results indicate that thickness, roughness, porosity and liquid uptake of the membranes increase with the amount of surfactant used, while their mechanical properties and stability in aqueous media decrease. Other important properties such as color and surface hydrophilicity (water contact angle) are not significantly altered or did not present a clear tendency of variation with the increase of the amount of surfactant added to the polyelectrolyte complexes, such as real density, average pore diameter, total pore volume and surface area. The prepared biomaterials were not cytotoxic to L929 cells. In conclusion, it is possible to tune the physicochemical properties of chitosan-alginate polyelectrolyte complexes, through the variation of the proportion of surfactant (Pluronic F68) added to the mixture, so as to enable the desired application of these biomaterials.
Resumo:
To characterize the recently described SCI1 (stigma/style cell cycle inhibitor 1) gene relationship with the auxin pathway, we have taken the advantage of the Arabidopsis model system and its available tools. At first, we have analyzed the At1g79200 T-DNA insertion mutants and constructed various transgenic plants. The loss- and gain-of-function plants displayed cell number alterations in upper pistils that were controlled by the amino-terminal domain of the protein. These data also confirmed that this locus holds the functional homolog (AtSCI1) of the Nicotiana tabacum SCI1 gene. Then, we have provided some evidences the auxin synthesis/signaling pathways are required for downstream proper AtSCI1 control of cell number: (a) its expression is downregulated in yuc2yuc6 and npy1 auxin-deficient mutants, (b) triple (yuc2yuc6sci1) and double (npy1sci1) mutants mimicked the auxin-deficient phenotypes, with no synergistic interactions, and (c) the increased upper pistil phenotype in these last mutants, which is a consequence of an increased cell number, was able to be complemented by AtSCI1 overexpression. Taken together, our data strongly suggests SCI1 as a component of the auxin signaling transduction pathway to control cell proliferation/differentiation in stigma/style, representing a molecular effector of this hormone on pistil development.
Resumo:
ICAM-1 expression on the villous syncytiotrophoblast (ST) is believed to participate in migration of maternal cells into the inflamed villi regardless of villitis etiology. However, its expression on immune cells in chronic villitis (CV) has yet to be analyzed. ICAM-1 induces cell-cell adhesion allowing intercellular communication, T cell-mediated defense mechanism, and inflammatory response. 21 cases of CV (all without an identifiable etiologic agent) and 3 control placentas were analyzed using ICAM-1, and for immune cells CD45, CD3 and CD68. These cells were subdivided according to their location in inflamed villi: a) within the inflamed villi and b) outside forming perivillous aggregates. Large amounts of CD45, CD3 and CD68 were found within the inflamed villi and forming perivillous aggregates attached to areas of trophoblastic loss. Inflamed villi usually showed ICAM-1+ ST. The majority of immune cells surrounding areas of trophoblastic rupture presented marked expression of ICAM-1. In contrast, a small number of immune cells within the inflamed villi exhibited ICAM-1 expression. Only some (<5%) inflamed villi without trophoblastic rupture and with ICAM-1+ ST presented adherence of immune cells. In inflamed villi of chronic villitis, the level of ICAM-1 expression on immune cells depends on their location: high in number of cells in the perivillous region and low within the villi. The strongest expression of ICAM-1 on immune cells attached to areas of trophoblastic rupture suggests that the loss of trophoblast can lead to an amplification of the inflammatory response.
Resumo:
Up to 20% of women with hypertensive pregnancy disorders might persist with chronic hypertension. This study compared clinical and echocardiographic features between women whose hypertension began as hypertensive pregnancy disorders (PH group) and women whose diagnosis of hypertension did not occur during pregnancy (NPH group). Fifty PH and 100 NPH women were cross-sectionally evaluated by clinical, laboratory, and echocardiography analysis, and the groups were matched by duration of hypertension. PH exhibited lower age (46.6 ± 1.4 vs. 65.3 ± 1.1 years; P < .001), but higher systolic (159.8 ± 3.9 vs. 148.0 ± 2.5 mm Hg; P = .009) and diastolic (97.1 ± 2.4 vs. 80.9 ± 1.3 mm Hg; P < .001) blood pressure than NPH, although used more antihypertensive classes (3.4 ± 0.2 vs. 2.6 ± 0.1; P < .001). Furthermore, PH showed higher left ventricular wall thickness and increased prevalence of concentric hypertrophy than NPH after adjusting for age and blood pressure. In conclusion, this study showed that PH may exhibit worse blood pressure control and adverse left ventricular remodeling compared with NPH.
Resumo:
The role of key cell cycle regulation genes such as, CDKN1B, CDKN2A, CDKN2B, and CDKN2C in sporadic medullary thyroid carcinoma (s-MTC) is still largely unknown. In order to evaluate the influence of inherited polymorphisms of these genes on the pathogenesis of s-MTC, we used TaqMan SNP genotyping to examine 45 s-MTC patients carefully matched with 98 controls. A multivariate logistic regression analysis demonstrated that CDKN1B and CDKN2A genes were related to s-MTC susceptibility. The rs2066827*GT+GG CDKN1B genotype was more frequent in s-MTC patients (62.22%) than in controls (40.21%), increasing the susceptibility to s-MTC (OR=2.47; 95% CI=1.048-5.833; P=0.038). By contrast, the rs11515*CG+GG of CDKN2A gene was more frequent in the controls (32.65%) than in patients (15.56%), reducing the risk for s-MTC (OR=0.174; 95% CI=0.048-0.627; P=0.0075). A stepwise regression analysis indicated that two genotypes together could explain 11% of the total s-MTC risk. In addition, a relationship was found between disease progression and the presence of alterations in the CDKN1A (rs1801270), CDKN2C (rs12885), and CDKN2B (rs1063192) genes. WT rs1801270 CDKN1A patients presented extrathyroidal tumor extension more frequently (92%) than polymorphic CDKN1A rs1801270 patients (50%; P=0.0376). Patients with the WT CDKN2C gene (rs12885) presented larger tumors (2.9±1.8 cm) than polymorphic patients (1.5±0.7 cm; P=0.0324). On the other hand, patients with the polymorphic CDKN2B gene (rs1063192) presented distant metastases (36.3%; P=0.0261). In summary, we demonstrated that CDKN1B and CDKN2A genes are associated with susceptibility, whereas the inherited genetic profile of CDKN1A, CDKN2B, and CDKN2C is associated with aggressive features of tumors. This study suggests that profiling cell cycle genes may help define the risk and characterize s-MTC aggressiveness.
Resumo:
Gellan microgels with potential application in delivery systems were obtained by physically cross-linked gellan gum. The microgels were produced by atomization followed by ionotropic gelation using CaCl2 (gellan/Ca) or KCl (gellan/K) as hardening agent and part of them were coated with chitosan in order to improve their resistance to gastric digestion. Size distribution, morphology and zeta potential of microgels were evaluated before and after in vitro digestion process. The long term stability was also evaluated. Spherical microparticles were obtained at gellan concentration above 0.6% w/w, showing average size among 70-120 μm. Most of the coated and uncoated microgels showed stability in aqueous media, except the uncoated gellan/K microgel. The in vitro digestion evaluation showed that all particles maintained their size and shape after the gastric digestion step. However, the enteric digestion caused disintegration of microgels indicating their potential application for enteric delivery systems. The chitosan-coated microgels showed lower degree of fragmentation when compared to the uncoated microgels, indicating that the coating process enable a better control of microgels releasing properties during the enteric digestion.