14 resultados para Conselho de defesa Sul-americano

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

In Myrocarpus, an exclusively South American genus, five species are recognised: Myrocarpus frondosus Allemão, M. leprosus Pickel, M. venezuelensis Rudd, M. fastigiatus Allemãoand M. emarginatus A.L.B. Sartori & A.M.G. Azevedo. Morphologic data, habitat information and geographic distribution of each taxon are discussed. Petal morphology and ornamentation of seed chamber are an important character for species identification, though not shown previously. Key to the species, descriptions, illustrations, distribution, and new registers are presented.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Jaguariaiva region is located at Parana State, southern Brazil, and it keeps up the last remnants of savanna vegetation in the State. Thus, it should be considered a mark of the meridional distribution limit of this vegetation type in Brazil. The Parque Estadual do Cerrado (24º09' S; 50º18' WG), whose vegetation is not solely composed by savanna forms, was the object of this study that analysed the vegetation of two dominant savanna physiognomic types (cerrado sensu stricto and campo cerrado). Twenty quadrats of 200m² (20 x 10m) were sistematicaly established in each physiognomic unit, and all the individuals having Basal Perimeter (BP) over 15 cm were sampled. The survey results indicated a low number of woody species in both units (33 species in cerrado sensu stricto and 18 in campo cerrrado). Most important species were virtually the same for both units, specially Byrsonima coccolobifolia, Acosinium subelegans, Couepia grandiflora and Stryphnodendron adstringens. The total density, total dominance and diversity were higher in cerrado sensu stricto. Moreover. there was apparently a higher lloristic resemblance with savannas of São Paulo State, specially those located in the South of thc State.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Collection of triatomines in domestic, peridomestic and sylvatic environments in states of Bahia and Rio Grande do Sul, Northeastern and Southern Brazil respectively, and isolation of Trypanosoma cruzi strains. First, the captured triatomines were identified using insect identification keys, then their intestinal content was examined by abdominal compression, and the samples containing trypanosomatid forms were inoculated in LIT medium and Swiss mice. Six triatomine species were collected in cities in Bahia, namely Panstrongylus geniculatus (01), Triatoma melanocephala (11), T. lenti (94), T. pseudomaculata (02), T. sherlocki (26) and T. sordida (460), and two in cities in Rio Grande do Sul, namely T. circummaculata (11) and T. rubrovaria (115). Out of the specimens examined, T. cruzi was isolated from 28 triatomine divided into four different species: T. melanocephala (one), T. lenti (one), T. rubrovaria (16) and T. sordida (10). Their index of natural infection by T. cruzi was 6.4%. The isolation of T. cruzi strains from triatomines found in domestic and peridomestic areas shows the potential risk of transmission of Chagas disease in the studied cities. The maintenance of those T. cruzi strains in laboratory is intended to promote studies that facilitate the understanding of the parasite-vector-host relationship.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A study of the tree species of the order Celastrales sensu Cronquist from the Tibagi river basin, Paraná state, Brazil, is presented, based on herbarium material. This basin is subdivided into three zones, from north to south: lower Tibagi (BT), mid Tibagi (MT) and upper Tibagi (AT), each with different environmental conditions and vegetation types. The order Celastrales is represented in the basin by 15 tree species belonging to three families: Aquifoliaceae, Celastraceae and Icacinaceae. Icacinaceae has only two species, Citronella gongonha and C. paniculata. The former is distinguished by a glabrous ovary and leaves that usually bear thorns. Aquifoliaceae has six species: Ilex brasiliensis, I. brevicuspis, I. chamaedryfolia, I. dumosa, I. paraguariensis and I. theezans. These species are found mainly in AT and MT and are distinguished by leaf size, indument, apices and margins, and by sepal features. Celastrales is represented by seven species and two genera; Plenckia populnea, a Brazilian savannah species found only in MT, and six species of Maytenus (M. evonymoides, M. robusta, M. dasyclada, M. salicifolia, M. ilicifolia and M. aquifolia) distinguished by leaf size and margins, branch shape and number of flowers per inflorescence.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A revision of the Brazilian species of Lonchocarpus s. str. is presented. This study is based on field observation and an analysis of approximately 1,200 herbarium collections. Nine species are recognized, L. cultratus, L. hedyosmus, L. latifolius, L. macrocarpus, L. nitidus, L. pluvialis, L. sericeus, L. spiciflorus, and L. violaceus, which grow in forests and are usually associated with river banks. Lonchocarpus sericeus and L. cultratus have a wide distribution throughout Brazil, whereas L. hedyosmus, L. macrocarpus, L. spiciflorus, and L. latifolius are restricted to the Amazonian domain. Lonchocarpus pluvialis occurs in the Central-West (Mato Grosso do Sul and Goiás) and Southeast (São Paulo) regions. Lonchocarpus violaceus is found in the states of Bahia and Espírito Santo, and is reported for the first time for Brazil. Identification keys, descriptions, and illustrations, in addition to information about habitat, geographic distribution and taxonomic and nomenclatural comments, are provided for the species. Four new synonyms and five lectotypifications are proposed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: To evaluate the knowledge glaucoma patients have about their disease and its treatment. METHODS: One hundred and eighty-three patients were interviewed at the Glaucoma Service of Wills Eye Hospital (Philadelphia, USA, Group 1) and 100 at the Glaucoma Service of University of Campinas (Campinas, Brazil, Group 2). An informal, relaxed atmosphere was created by the interviewer before asking a list of 18 open-ended questions. RESULTS: In Group 1, 44% of the 183 patients did not have an acceptable idea about what glaucoma is, 30% did not know the purpose of the medications they were taking, 47% were not aware of what was an average intraocular pressure, and 45% did not understand why visual fields were examined. In Group 2, 54% gave unsatisfactory answers to the question What is glaucoma?, 54% did not know the purpose of the medications they were taking, 80% were not aware of what was an average intraocular pressure, and 94% did not understand why visual fields were examined (p<0.001). Linear regression analysis demonstrated that level of education was positively correlated to knowledge about glaucoma in both groups (r=0.65, p=0.001). CONCLUSION: This study showed that patients' knowledge about glaucoma varies greatly, and that in an urban, American setting, around one third of the patients have minimal understanding, whereas in an urban setting in Brazil around two thirds of patients were lacking basic information about glaucoma. Innovative and effective methods are needed to correct this situation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física