Pituitary Macroadenoma Presenting As A Nasal Tumor: Case Report.

Pituitary macroadenomas are rare intracranial tumors. In a few cases, they may present aggressive behavior and invade the sphenoid sinus and nasal cavity, causing unusual symptoms. In this paper, we report an atypical case of pituitary adenoma presenting as a nasal mass. The patient was a 44-year-old woman who had had amenorrhea and galactorrhea for ten months, with associated nasal obstruction, macroglossia and acromegaly. Both growth hormone and prolactin levels were increased. Magnetic resonance imaging showed a large mass originating from the lower surface of the pituitary gland, associated with sella turcica erosion and tumor extension through the sphenoid sinus and nasal cavity. Histopathological analysis demonstrated a chromophobe pituitary adenoma with densely packed rounded epithelial cells, with some atypias and rare mitotic figures. There was no evidence of metastases. Macroadenoma invading the nasal cavity is a rare condition and few similar cases have been reported in the literature. This study contributes towards showing that tumor extension to the sphenoid sinus and nasopharynx needs to be considered and investigated in order to make an early diagnosis when atypical symptoms like nasal obstruction are present.

Facial Changes After Early Treatment Of Unilateral Coronal Synostosis Question The Necessity Of Primary Nasal Osteotomy.

The premature fusion of unilateral coronal suture can cause a significant asymmetry of the craniofacial skeleton, with an oblique deviation of the cranial base that negatively impacts soft tissue facial symmetry. The purpose of this study was to assess facial symmetry obtained in patients with unilateral coronal synostosis (UCS) surgically treated by 2 different techniques. We hypothesized that nasal deviation should not be addressed in a primary surgical correction of UCS. Consecutive UCS patients were enrolled in a prospective study and randomly divided into 2 groups. In group 1, the patients underwent total frontal reconstruction and transferring of onlay bone grafts to the recessive superior orbital rim (n = 7), and in group 2, the patients underwent total frontal reconstruction and unilateral fronto-orbital advancement (n = 5). Computerized photogrammetric analysis measured vertical and horizontal axis of the nose and the orbital globe in the preoperative and postoperative periods. Intragroup and intergroup comparisons were performed. Intragroup preoperative and postoperative comparisons showed a significant (all P < 0.05) reduction of the nasal axis and the orbital-globe axis in the postoperative period in the 2 groups. Intergroup comparisons showed no significant difference (all P > 0.05). Facial symmetry was achieved in the patients with UCS who underwent surgery regardless of surgical approach evaluated here. Our data showed a significant improvement in nasal and orbital-globe deviation, leading us to question the necessity of primary nasal correction in these patients.

Nasal Potential Difference In Cystic Fibrosis Considering Severe Cftr Mutations.

The gold standard for diagnosing cystic fibrosis (CF) is a sweat chloride value above 60 mEq/L. However, this historical and important tool has limitations; other techniques should be studied, including the nasal potential difference (NPD) test. CFTR gene sequencing can identify CFTR mutations, but this method is time-consuming and too expensive to be used in all CF centers. The present study compared CF patients with two classes I-III CFTR mutations (10 patients) (G1), CF patients with classes IV-VI CFTR mutations (five patients) (G2), and 21 healthy subjects (G3). The CF patients and healthy subjects also underwent the NPD test. A statistical analysis was performed using the Mann-Whitney, Kruskal-Wallis, χ(2), and Fisher's exact tests, α = 0.05. No differences were observed between the CF patients and healthy controls for the PDMax, Δamiloride, and Δchloride + free + amiloride markers from the NPD test. For the finger value, a difference between G2 and G3 was described. The Wilschanski index values were different between G1 and G3. In conclusion, our data showed that NPD is useful for CF diagnosis when classes I-III CFTR mutations are screened. However, if classes IV-VI are considered, the NPD test showed an overlap in values with healthy subjects.

Ocular masquerade syndrome associated with extranodal nasal natural killer/T-cell lymphoma: case report

A 33-year-old woman complained of unilateral eyelid edema and blurred vision. Initial ophthalmic examination disclosed anterior chamber reaction with keratic precipitates on the cornea, without posterior abnormalities. Anterior uveitis was treated. Despite that, patient showed rapidly progressive unilateral vision loss with optic nerve swelling. Systemic workup was inconclusive, as well as cranial magnetic resonance imaging and cerebrospinal fluid examination. Based on the hypothesis of optic neuritis, intravenous methylprednisolone pulse was performed with no success. During the following days, the patient presented pericardial effusion and cardiac tamponade, progressing to death. Necropsy was performed and diagnosis of extranodal natural killers/T-cell lymphoma, nasal type with ocular involvement was confirmed by immunohistochemistry.

Otorhinolaryngological Findings In A Group Of Patients With Rheumatic Diseases.

Otorhinolaryngological manifestations of rheumatologic diseases represent a great challenge not only to the generalistphysician but also to the ENT doctor andrheumatologist. They often represent early manifestations of an autoimmune disorder which requires prompt and aggressive immunosuppressive treatment. Auditory, nasal, laryngeal and eye symptoms can be the first manifestation of rheumatic diseases and their proper assessment helps the doctor to identify signs of disease activity. The objective of this study is to identify the ENT manifestations in patients with rheumatic diseases in a high complexity hospital, regarding facilitating an early diagnosis and treatment. We performed clinical and complete otorhinolaryngological evaluations in patients selected from the outpatient rheumatology in a standardized manner by the use of a standardized form filling during the secondhalf of 2010. In the study group, systemic lupus erythematosus (SLE) patients had predominantly laryngeal manifestations, while patients with Sjögren's syndrome showed a higher prevalence of otologic manifestations. Changes in audiometric tests were found in 53% of Wegener's granulomatosis (WG) patients, 80% of relapsing polychondritis (RP), 33% of systemic lupus erythematosus (SLE) and 50% of Churg-Strauss syndrome (SCS). Regarding nasal alterations, these were found so prevalent in all conditions, especially Churg-Strauss syndrome. This study demonstrated that most patients treated in our hospital has the ENT signs and symptoms commonly associated in previous studies on rheumatic diseases, but further studies with a larger number of patients must be made to establish such relations.

Cephalometric And Anthropometric Data Of Obstructive Apnea In Different Age Groups.

Patients with obstructive sleep apnea syndrome usually present with changes in upper airway morphology and/or body fat distribution, which may occur throughout life and increase the severity of obstructive sleep apnea syndrome with age. To correlate cephalometric and anthropometric measures with obstructive sleep apnea syndrome severity in different age groups. A retrospective study of cephalometric and anthropometric measures of 102 patients with obstructive sleep apnea syndrome was analyzed. Patients were divided into three age groups (≥20 and <40 years, ≥40 and <60 years, and ≥60 years). Pearson's correlation was performed for these measures with the apnea-hypopnea index in the full sample, and subsequently by age group. The cephalometric measures MP-H (distance between the mandibular plane and the hyoid bone) and PNS-P (distance between the posterior nasal spine and the tip of the soft palate) and the neck and waist circumferences showed a statistically significant correlation with apnea-hypopnea index in both the full sample and in the ≥40 and <60 years age group. These variables did not show any significant correlation with the other two age groups (<40 and ≥60 years). Cephalometric measurements MP-H and PNS-P and cervical and waist circumferences correlated with obstructive sleep apnea syndrome severity in patients in the ≥40 and <60 age group.

Frequency of the different mutations causing spinocerebellar ataxia (SCA1, SCA2, MJD/SCA3 and DRPLA) in a large group of Brazilian patients

Spinocerebellar ataxia type 1 (SCA1), spinocerebellar ataxia type 2 (SCA2) and Machado-Joseph disease or spinocerebellar ataxia type 3 (MJD/SCA3) are three distinctive forms of autosomal dominant spinocerebellar ataxia (SCA) caused by expansions of an unstable CAG repeat localized in the coding region of the causative genes. Another related disease, dentatorubropallidoluysian atrophy (DRPLA) is also caused by an unstable triplet repeat and can present as SCA in late onset patients. We investigated the frequency of the SCA1, SCA2, MJD/SCA3 and DRPLA mutations in 328 Brazilian patients with SCA, belonging to 90 unrelated families with various patterns of inheritance and originating in different geographic regions of Brazil. We found mutations in 35 families (39%), 32 of them with a clear autosomal dominant inheritance. The frequency of the SCA1 mutation was 3% of all patients; and 6 % in the dominantly inherited SCAs. We identified the SCA2 mutation in 6% of all families and in 9% of the families with autosomal dominant inheritance. The MJD/SCA3 mutation was detected in 30 % of all patients; and in the 44% of the dominantly inherited cases. We found no DRPLA mutation. In addition, we observed variability in the frequency of the different mutations according to geographic origin of the patients, which is probably related to the distinct colonization of different parts of Brazil. These results suggest that SCA may be occasionally caused by the SCA1 and SCA2 mutations in the Brazilian population, and that the MJD/SCA3 mutation is the most common cause of dominantly inherited SCA in Brazil.

Seed dispersal of Solanum thomasiifolium Sendtner (Solanaceae) in the Linhares Forest, Espírito Santo state, Brazil

The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of nativo vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous), and one species of lizard (Tropidurus torquatus) fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds), 19% (crab-eating fox) and 4% (lizards). Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control), bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Flicker perimetry in healthy subjects: influence of age and gender, learning effect and short-term fluctuation

PURPOSE: To determine the mean critical fusion frequency and the short-term fluctuation, to analyze the influence of age, gender, and the learning effect in healthy subjects undergoing flicker perimetry. METHODS: Study 1 - 95 healthy subjects underwent flicker perimetry once in one eye. Mean critical fusion frequency values were compared between genders, and the influence of age was evaluated using linear regression analysis. Study 2 - 20 healthy subjects underwent flicker perimetry 5 times in one eye. The first 3 sessions were separated by an interval of 1 to 30 days, whereas the last 3 sessions were performed within the same day. The first 3 sessions were used to investigate the presence of a learning effect, whereas the last 3 tests were used to calculate short-term fluctuation. RESULTS: Study 1 - Linear regression analysis demonstrated that mean global, foveal, central, and critical fusion frequency per quadrant significantly decreased with age (p<0.05).There were no statistically significant differences in mean critical fusion frequency values between males and females (p>0.05), with the exception of the central area and inferonasal quadrant (p=0.049 and p=0.011, respectively), where the values were lower in females. Study 2 - Mean global (p=0.014), central (p=0.008), and peripheral (p=0.03) critical fusion frequency were significantly lower in the first session compared to the second and third sessions. The mean global short-term fluctuation was 5.06±1.13 Hz, the mean interindividual and intraindividual variabilities were 11.2±2.8% and 6.4±1.5%, respectively. CONCLUSION: This study suggests that, in healthy subjects, critical fusion frequency decreases with age, that flicker perimetry is associated with a learning effect, and that a moderately high short-term fluctuation is expected.

Corporeidade e cultura amazonica : re-flexões a partir do passaro junino do Para

Universidade Estadual de Campinas . Faculdade de Educação Física