Frequency of the different mutations causing spinocerebellar ataxia (SCA1, SCA2, MJD/SCA3 and DRPLA) in a large group of Brazilian patients

Spinocerebellar ataxia type 1 (SCA1), spinocerebellar ataxia type 2 (SCA2) and Machado-Joseph disease or spinocerebellar ataxia type 3 (MJD/SCA3) are three distinctive forms of autosomal dominant spinocerebellar ataxia (SCA) caused by expansions of an unstable CAG repeat localized in the coding region of the causative genes. Another related disease, dentatorubropallidoluysian atrophy (DRPLA) is also caused by an unstable triplet repeat and can present as SCA in late onset patients. We investigated the frequency of the SCA1, SCA2, MJD/SCA3 and DRPLA mutations in 328 Brazilian patients with SCA, belonging to 90 unrelated families with various patterns of inheritance and originating in different geographic regions of Brazil. We found mutations in 35 families (39%), 32 of them with a clear autosomal dominant inheritance. The frequency of the SCA1 mutation was 3% of all patients; and 6 % in the dominantly inherited SCAs. We identified the SCA2 mutation in 6% of all families and in 9% of the families with autosomal dominant inheritance. The MJD/SCA3 mutation was detected in 30 % of all patients; and in the 44% of the dominantly inherited cases. We found no DRPLA mutation. In addition, we observed variability in the frequency of the different mutations according to geographic origin of the patients, which is probably related to the distinct colonization of different parts of Brazil. These results suggest that SCA may be occasionally caused by the SCA1 and SCA2 mutations in the Brazilian population, and that the MJD/SCA3 mutation is the most common cause of dominantly inherited SCA in Brazil.

Orbital apex syndrome due to aspergillosis: case report

We report the case of a 73-year-old female who presented facial numbness and pain in the first division of the trigeminal nerve, ptosis, diplopia and visual loss on the right side for the previous four months. The neurological, radiological and histological examination demonstrated a rare case of invasive fungal aspergillosis of the central nervous system, causing orbital apex syndrome, later transformed in temporal brain abscess. She died ten months later due to respiratory and renal failure in spite of specific antimycotic therapy.

Seed dispersal of Solanum thomasiifolium Sendtner (Solanaceae) in the Linhares Forest, Espírito Santo state, Brazil

The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of nativo vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous), and one species of lizard (Tropidurus torquatus) fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds), 19% (crab-eating fox) and 4% (lizards). Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control), bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Candidíase sistêmica com localização encefálica: estudo anátomo-clínico de cinco casos

Central nervous system involvement in Candida septicaemia is rare and not more than four cases have been published in Brazil. Five new cases of systemic candidiasis with cerebral lesions are reported. All patients (four adults and a child) had serious underlying diseases and were submitted to heavy long-term antibiotic therapy with multiple drugs. Seizures in one case and neck stiffness in another were the only neurologic signs that could be attributed to candidiasis. In no case were the lesions severe enough to be considered an immediate cause of death. In three patients, no macroscopic changes were evident in the brain, but microabscesses and granulomata were observed on microscopical examination; another patient had two gross areas with necrotic and haemorrhagic appearance in the cerebral hemispheres; the child had only two microscopic granulomata. The aetiological agent was demonstrated by Grocott's methenamine silver technique in all cases. Involvement of organs other than the central nervous system could be demonstrated in three autopsies. Discussion is confined mainly to such aspects as the contributory factors in the pathogenesis of systemic candidiasis as well as the marked rise in the incidence of this condition in the past few decades. It is suggested that the frequence of monilial septicaemia in Brazil may be far more serious than apparent from the scarcity of reported cases.

Corporeidade e cultura amazonica : re-flexões a partir do passaro junino do Para

Universidade Estadual de Campinas . Faculdade de Educação Física