8 resultados para Clinical stages of infection

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

This clinical study assessed the influence of different intracanal medications on Th1-type and Th2-type cytokine responses in apical periodontitis and monitored the levels of bacteria from primarily infection during endodontic procedures. Thirty primarily infected teeth were randomly divided into 3 groups according to the medication selected: chlorhexidine (CHX), 2% CHX gel; Ca(OH)2/SSL, Ca(OH)2 + SSL; and Ca(OH)2/CHX, Ca(OH)2 + 2% CHX gel (all, n = 10). Bacterial sample was collected from root canals, and the interstitial fluid was sampled from lesions. Culture techniques were used to determine bacterial counts (colony-forming units/mL). Th1 (tumor necrosis factor-α, interferon-γ, and interleukin [IL]-2) and Th2 cytokines (IL-4, IL-5, and IL-13) were measured by enzyme-linked immunosorbent assay. All intracanal medication protocols were effective in reducing the bacterial load from root canals (all P < .05) and lowering the levels of Th1-type cytokines in apical lesions (all P < .05), with no differences between them (P > .05). Both Ca(OH)2 treatment protocols significantly increased the levels of Th2-type cytokines (P < .05), with no differences between them (P > .05). Thus, chlorhexidine medication showed the lowest effectiveness in increasing the levels of Th2-type cytokine. After treatment, regardless of the type of medication, the linear regression analysis indicated the down-regulation of Th2-type cytokines by Th1-type cytokines. All intracanal medication protocols were effective in reducing bacterial load and lowering the levels of Th1-type cytokines. Thus, the use of Ca(OH)2 medications contributed to the increase in the Th2-type cytokine response in apical periodontitis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The cerebellum is an important site for cortical demyelination in multiple sclerosis, but the functional significance of this finding is not fully understood. To evaluate the clinical and cognitive impact of cerebellar grey-matter pathology in multiple sclerosis patients. Forty-two relapsing-remitting multiple sclerosis patients and 30 controls underwent clinical assessment including the Multiple Sclerosis Functional Composite, Expanded Disability Status Scale (EDSS) and cerebellar functional system (FS) score, and cognitive evaluation, including the Paced Auditory Serial Addition Test (PASAT) and the Symbol-Digit Modalities Test (SDMT). Magnetic resonance imaging was performed with a 3T scanner and variables of interest were: brain white-matter and cortical lesion load, cerebellar intracortical and leukocortical lesion volumes, and brain cortical and cerebellar white-matter and grey-matter volumes. After multivariate analysis high burden of cerebellar intracortical lesions was the only predictor for the EDSS (p<0.001), cerebellar FS (p = 0.002), arm function (p = 0.049), and for leg function (p<0.001). Patients with high burden of cerebellar leukocortical lesions had lower PASAT scores (p = 0.013), while patients with greater volumes of cerebellar intracortical lesions had worse SDMT scores (p = 0.015). Cerebellar grey-matter pathology is widely present and contributes to clinical dysfunction in relapsing-remitting multiple sclerosis patients, independently of brain grey-matter damage.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Scorpion stings account for most envenomations by venomous animals in Brazil. A retrospective study (1994-2011) of the clinical consequences of Tityus scorpion stings in 1327 patients treated at a university hospital in Campinas, southeastern Brazil, is reported. The clinical classification, based on outcome, was: dry sting (no envenoming), class I (only local manifestations), class II (systemic manifestations), class III (life-threatening manifestations, such as shock and/or cardiac failure requiring inotropic/vasopressor agents, and/or respiratory failure), and fatal. The median patient age was 27 years (interquartile interval = 15-42 years). Scorpions were brought for identification in 47.2% of cases (Tityus bahiensis 27.7%; Tityus serrulatus 19.5%). Sting severity was classified and each accounted for the following percentage of cases: dry stings - 3.4%, class I - 79.6%, class II - 15.1%, class III - 1.8% and fatal - 0.1%. Pain was the primary local manifestation (95.5%). Systemic manifestations such as vomiting, agitation, sweating, dyspnea, bradycardia, tachycardia, tachypnea, somnolence/lethargy, cutaneous paleness, hypothermia and hypotension were detected in class II or class III + fatal groups, but were significantly more frequent in the latter group. Class III and fatal cases occurred only in children <15 years old, with scorpions being identified in 13/25 cases (T. serrulatus, n = 12; T. bahiensis, n = 1). Laboratory blood abnormalities (hyperglycemia, hypokalemia, leukocytosis, elevations in serum total CK, CK-MB and troponin T, bicarbonate consumption and an increase in base deficit and blood lactate), electrocardiographic changes (ST segment) and echocardiographic alterations (ventricular ejected fraction <54%) were frequently detected in class III patients. Seventeen patients developed pulmonary edema, 16 had cardiac failure and seven had cardiogenic shock. These results indicate that most scorpion stings involved only local manifestations, mainly pain; the greatest severity was associated with stings by T. serrulatus and in children <15 years old.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Brazilian epidemiological studies on rheumatoid arthritis are scarce, mainly in the northeast; thus many data currently available originate from the international literature. To describe demographic, clinical and serological characteristics of patients with rheumatoid arthritis (RA) followed-up by the same physician, in state of Piauí, Brazil. Data were collected between August 2010 and March 2013, in three health services of Piauí that provided health care in Rheumatology: a university-affiliated hospital, a public outpatient clinic and a private clinic. The numbers represent mean ± SD or percentage: 47.5±11.03 years-old non-Caucasian woman, non-smoker (59.2%), low educational level, mean disease duration of 7.7 years ± 7.6, and major extra-articular manifestations were rheumatoid nodules (19.4%) and sicca syndrome (46.9%). Features of rheumatoid arthritis obtained in this study are similar to those found in some national and international studies, but we observed higher female preponderance and illiteracy rate, in addition to a moderately severe erosive disease on average, with frequent sicca and other extra-articular manifestations.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Haemophilia and its treatment interfere with patients' life and may affect adherence to treatment. This study explored the impact of severe haemophilia A on patients' health status, especially in young adults (YA), using data from guardian(™) 1, a multinational, open-label, non-controlled phase 3 trial investigating safety and efficacy of turoctocog alfa (NovoEight(®) ) in previously treated patients aged 12 years and older with severe haemophilia A (FVIII ≤ 1%). Health status was assessed using the EuroQoL-5 dimensions (EQ-5D-3L), covering 5 dimensions of health (mobility, self-care, usual activities, pain/discomfort and anxiety/depression), and a visual analogue scale (VAS) measuring self-rated overall health status. EQ-5D was administered pretreatment (screening/baseline) and posttreatment (end-of-trial). Baseline responses to the EQ-5D dimensions and VAS were described overall and by age and compared to reference values from UK general population. Guardian(™) 1 included 150 patients (16 adolescents, 83 YA aged 16-29 and 51 adults aged 30+). All five dimensions of patients' health status were impacted at baseline. The percentage of haemophilia patients reporting problems was consistently significantly greater than age-matched general population reference values. Likewise, for all age groups mean baseline EQ-5D VAS score was significantly lower for haemophilia patients (YA: 78.0) than for the general population (YA aged 18-29: 87.3). The health status of patients with severe haemophilia A entering guardian(™) 1 was markedly poorer than that of the general population, particularly regarding mobility and pain. YA patients reported better health status than older patients, but considerably lower than that of the general YA population.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this prospective study was to determine the plasma levels of nitric oxide (NO) in women with chronic pelvic pain secondary to endometriosis (n=24) and abdominal myofascial pain syndrome (n=16). NO levels were measured in plasma collected before and 1 month after treatment. Pretreatment NO levels (μM) were lower in healthy volunteers (47.0±12.7) than in women with myofascial pain (64.2±5.0, P=0.01) or endometriosis (99.5±12.9, P<0.0001). After treatment, plasma NO levels were reduced only in the endometriosis group (99.5±12.9 vs 61.6±5.9, P=0.002). A correlation between reduction of pain intensity and reduction of NO level was observed in the endometriosis group [correlation = 0.67 (95%CI = 0.35 to 0.85), P<0.0001]. Reduction of NO levels was associated with an increase of pain threshold in this group [correlation = -0.53 (-0.78 to -0.14), P<0.0001]. NO levels appeared elevated in women with chronic pelvic pain diagnosed as secondary to endometriosis, and were directly associated with reduction in pain intensity and increase in pain threshold after treatment. Further studies are needed to investigate the role of NO in the pathophysiology of pain in women with endometriosis and its eventual association with central sensitization.