Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Genome Sequence Of Streptomyces Wadayamensis Strain A23, An Endophytic Actinobacterium From Citrus Reticulata.

The actinobacterium Streptomyces wadayamensis A23 is an endophyte of Citrus reticulata that produces the antimycin and mannopeptimycin antibiotics, among others. The strain has the capability to inhibit Xylella fastidiosa growth. The draft genome of S. wadayamensis A23 has ~7.0 Mb and 6,006 protein-coding sequences, with a 73.5% G+C content.

Molecular Genetic Variability Of Commercial And Wild Accessions Of Passion Fruit (passiflora Spp.) Targeting Ex Situ Conservation And Breeding.

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Semi-determinate Growth Habit Adjusts The Vegetative-to-reproductive Balance And Increases Productivity And Water-use Efficiency In Tomato (solanum Lycopersicum).

Tomato (Solanum lycopersicum) shows three growth habits: determinate, indeterminate and semi-determinate. These are controlled mainly by allelic variation in the SELF-PRUNING (SP) gene family, which also includes the florigen gene SINGLE FLOWER TRUSS (SFT). Determinate cultivars have synchronized flower and fruit production, which allows mechanical harvesting in the tomato processing industry, whereas indeterminate ones have more vegetative growth with continuous flower and fruit formation, being thus preferred for fresh market tomato production. The semi-determinate growth habit is poorly understood, although there are indications that it combines advantages of determinate and indeterminate growth. Here, we used near-isogenic lines (NILs) in the cultivar Micro-Tom (MT) with different growth habit to characterize semi-determinate growth and to determine its impact on developmental and productivity traits. We show that semi-determinate genotypes are equivalent to determinate ones with extended vegetative growth, which in turn impacts shoot height, number of leaves and either stem diameter or internode length. Semi-determinate plants also tend to increase the highly relevant agronomic parameter Brix×ripe yield (BRY). Water-use efficiency (WUE), evaluated either directly as dry mass produced per amount of water transpired or indirectly through C isotope discrimination, was higher in semi-determinate genotypes. We also provide evidence that the increases in BRY in semi-determinate genotypes are a consequence of an improved balance between vegetative and reproductive growth, a mechanism analogous to the conversion of the overly vegetative tall cereal varieties into well-balanced semi-dwarf ones used in the Green Revolution.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Qualidade pós-colheita de caqui 'fuyu' com utilização de diferentes concentrações de cobertura comestível

One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Analise do desenvolvimento das praticas urbanas de lazer relacionadas a produção cultural no periodo nacional-desenvolvimentista a globalização atraves da Teoria da Ação Comunicativa

Universidade Estadual de Campinas . Faculdade de Educação Física