Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

On Advertisement Call Of The Poison Frog Ameerega Berohoka (dendrobatidae, Anura) From The Brazilian Cerrado.

The poison frog genus Ameerega (Dendrobatidae) currently contains 32 species. They are distributed from central Brazil into western Amazonia to the lower Andean versant. In addition, three trans-Andean species have been allocated to Ameerega (Andrade et al. 2013; Frost 2014). Ameerega berohoka (Vaz-Silva & Maciel 2011) was described based on specimens from central Brazil (type-locality: Arenópolis, GO) and it is assumed to occur in parts of western and southwestern state of Goiás (Frost 2014). More recently, Andrade et al. (2013) extended its distribution to the state of Mato Grosso. Here we re-describe the advertisement call of A. berohoka, providing additional information regarding its temporal structure and spectral traits. Our observations also consist of a new distribution record for this species to the state of Mato Grosso.

Influence Of The Stage Of Ripeness On The Composition Of Iridoids And Phenolic Compounds In Genipap (genipa Americana L.).

Genipap fruits, native to the Amazon region, were classified in relation to their stage of ripeness according to firmness and peel color. The influence of the part of the genipap fruit and ripeness stage on the iridoid and phenolic compound profiles was evaluated by HPLC-DAD-MS(n), and a total of 17 compounds were identified. Geniposide was the major compound in both parts of the unripe genipap fruits, representing >70% of the total iridoids, whereas 5-caffeoylquinic acid was the major phenolic compound. In ripe fruits, genipin gentiobioside was the major compound in the endocarp (38%) and no phenolic compounds were detected. During ripening, the total iridoid content decreased by >90%, which could explain the absence of blue pigment formation in the ripe fruits after their injury. This is the first time that the phenolic compound composition and iridoid contents of genipap fruits have been reported in the literature.

Evaluation Of The Cytotoxicity And Phototoxicity Of Caryocar Brasiliense Supercritical Carbon Dioxide Extract.

Caryocar brasiliense Camb (Pequi) is a typical Brazilian Cerrado fruit tree. Its fruit is used as a vitamin source for culinary purposes and as a source of oil for the manufacture of cosmetics. C. brasiliense supercritical CO2 extracts exhibit antimicrobial activity against the bacteria Escherichia coli, Pseudomonas aeruginosa, and Staphylococcus aureus and also possess antioxidant activity. This study was designed to evaluate the in vitro cytotoxicity and phototoxicity of the supercritical CO2 extract obtained from the leaves of this species. In vitro cytotoxicity and phototoxicity of C. brasiliense supercritical CO2 extracts were assessed using a tetrazolium-based colorimetric assay (XTT) and Neutral Red methods. We found that the C. brasiliense (Pequi) extract obtained by supercritical CO2 extraction did not present cytotoxic and phototoxic hazards. This finding suggests that the extract may be useful for the development of cosmetic and/or pharmaceutical products.

Action Of Essential Oils From Brazilian Native And Exotic Medicinal Species On Oral Biofilms.

Essential oils (EO) obtained from twenty medicinal and aromatic plants were evaluated for their antimicrobial activity against the oral pathogens Candida albicans, Fusobacterium nucleatum, Porphyromonas gingivalis, Streptococcus sanguis and Streptococcus mitis. The antimicrobial activity of the EO was evaluates by microdilution method determining Minimal Inhibitory Concentration. Chemical analysis of the oils compounds was performed by Gas chromatography-mass spectrometry (CG-MS). The most active EO were also investigated as to their actions on the biolfilm formation. The most of the essential oils (EO) presented moderate to strong antimicrobial activity against the oral pathogens (MIC--Minimal Inhibitory Concentrations values between 0.007 and 1.00 mg/mL). The essential oil from Coriandrum sativum inhibited all oral species with MIC values from 0.007 to 0.250 mg/mL, and MBC/MFC (Minimal Bactericidal/Fungicidal Concentrations) from 0.015 to 0.500 mg/mL. On the other hand the essential oil of C. articulatus inhibited 63.96% of S. sanguis biofilm formation. Through Scanning Eletronic Microscopy (SEM) images no changes were observed in cell morphology, despite a decrease in biofilm formation and changes on biofilm structure. Chemical analysis by Gas Chromatography-Mass Spectrometry (GC-MS) of the C. sativum essential oil revealed major compounds derivatives from alcohols and aldehydes, while Cyperus articulatus and Aloysia gratissima (EOs) presented mono and sesquiterpenes. In conclusion, the crude oil from C. articulatus exhibited the best results of antimicrobial activity e ability to control biofilm formation. The chemical analysis showed the presence of terpenes and monoterpenes such as a-pinene, a-bulnesene and copaene. The reduction of biofilms formation was confirmed from SEM images. The results of this research shows a great potential from the plants studied as new antimicrobial sources.

Molecular Genetic Variability Of Commercial And Wild Accessions Of Passion Fruit (passiflora Spp.) Targeting Ex Situ Conservation And Breeding.

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Análise da estrutura de duas unidades fitofisionômicas de savana (cerrado) no sul do Brasil

The Jaguariaiva region is located at Parana State, southern Brazil, and it keeps up the last remnants of savanna vegetation in the State. Thus, it should be considered a mark of the meridional distribution limit of this vegetation type in Brazil. The Parque Estadual do Cerrado (24º09' S; 50º18' WG), whose vegetation is not solely composed by savanna forms, was the object of this study that analysed the vegetation of two dominant savanna physiognomic types (cerrado sensu stricto and campo cerrado). Twenty quadrats of 200m² (20 x 10m) were sistematicaly established in each physiognomic unit, and all the individuals having Basal Perimeter (BP) over 15 cm were sampled. The survey results indicated a low number of woody species in both units (33 species in cerrado sensu stricto and 18 in campo cerrrado). Most important species were virtually the same for both units, specially Byrsonima coccolobifolia, Acosinium subelegans, Couepia grandiflora and Stryphnodendron adstringens. The total density, total dominance and diversity were higher in cerrado sensu stricto. Moreover. there was apparently a higher lloristic resemblance with savannas of São Paulo State, specially those located in the South of thc State.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Flora e aspectos auto-ecológicos de um encrave de cerrado na chapada do Araripe, Nordeste do Brasil

This study subject to investigate the floristic composition and richness, the reproductive phenological patterns, the dispersal syndromes and life forms of species of a disjunt cerrado in semiarid climate at Araripe plateau during a one year period. We found 107 species and 41 families. Fabaceae, Myrtaceae, Poaceae, Apocynaceae, Euphorbiaceae and Malpighiaceae showed the largest number of species. For 47 of the woody species found, we studied the geographical distribution based on 27 papers of the Brazilian cerrados. Twelve species are of widespread occurence in the cerrado, and 13 are restricted to the Araripe plateau. Zoocory, autocory, and anemocory are the predominant syndromes of dispersal. The predominant life forms were phanerophytes (50.7%), hemicriptophytes (14.9%) and camephytes (13.1%). The cerrado of Araripe have lower species richness than continous cerrados, but a similar pattern of reproductive phenology, dispersal syndromes and life forms in more humid zones.

Produção de serapilheira e decomposição do material foliar em um cerradão na Estação Ecológica de Jataí, município de Luiz Antônio, SP, Brasil

We estimate litter production and leaf decomposition rate in a cerradão area, physiognomy little studied and very threatened in São Paulo State. During the period of study, litter production was 5646.9 kg.ha-1.year-1, which the 'leaf' fraction corresponded to 4081.2 kg.ha¹.year¹; the 'branch' fraction, to 1066.1 kg.ha-1.year-1; the 'reproductive structures' fraction, to 434.1 kg.ha-1.year-1; and the 'miscellaneous' fraction to 65.5 kg.ha-1.year-1. Litter production was highly seasonal and negatively correlated with relative humidity and air temperature. Leaf production was negatively correlated with relative humidity, rainfall, and air temperature. There was no significant difference between litter production found in this study and those in two other sites with cerradão and semideciduous forest, but these physiognomies differed significantly from the cerrado sensu stricto. Leaf decomposition rate (K) was 0.56. Half-life of the decomposing material was 1.8 years and turnover time was 2.3 years.

Morfoanatomia da raiz tuberosa de Vernonia oxylepis Sch. Bip. in Mart. ex Baker - Asteraceae

Several native herbaceous and subshrub species native to the Cerrado in Brazil are geophytes, that is, they survive the unfavorable dry season and low temperatures, that sometimes coincide with fire, with only the underground system intact. Vernonia oxylepis is one of these species and the aim of this study was to describe the morpho-anatomy of the tuberous root and bud formation on this structure. The main axis of this root is perpendicular to the soil surface, and from which aerial shoots arise periodically throughout the life cycle. On the upper portion of the root, self-grafting of the shoots occurs. The root stores lipids and fructans, exhibits contraction and produces reparatory buds; adventitious buds arise from proliferated pericycle. These characteristics may be related to adaptation of this species to conditions in the Cerrado.

Is size structure a good measure of future trends of plant populations? an empirical approach using five woody species from the Cerrado (Brazilian savanna)

Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.

Ambientes de cultivo, recipientes e substratos na produção de biomassa foliar e radicular em mudas de maracujazeiro amarelo em Aquidauana - MS

The objective of the work was to evaluate the effects of environment, recipients, and substrate compositions in passion fruit (Passiflora edulis Sims f. flavicarpa Deg.) seedlings biomass production in Pantanal region from September to November of 2006. Experimental trials were conducted in four protected environments, in two types of containers and three different substrate compositions. The environments were: A1 (greenhouse covered with low-density, 150-microns-thick polyethylene film), A2 (monofilament black screened with mesh for 50% of shade), A3 (aluminized screened with mesh for 50% of shade) and A4 (environment covered with straw of native coconut palm); the recipients were: polyethylene bags (R1) (15 x 25 cm) and polystyrene trays (R2) (with 72 cells). There substrates were: S1 (soil + organic compost + vermiculite, 1:1: 1 v/v), S2 (soil + organic compost + sawdust, 1:1: 1 v/v) and S3 (soil + organic compost + vermiculite + sawdust, 1:1: 1/2: 1/2 v/v). The experimental design was completely randomized statistical analysis in split-split-plot, with fifteen replications. The treatments in the plot were environments, in the subplots were pots, and subsubplots were substrates (4 x 2 x 3 = 24 treatments). Fresh and dry mass of aerial and root system parts were evaluated. Environments with screen showed better results for seedlings of yellow passion fruit biomass in polyethylene bags. Polyethylene bags promoted higher biomasses. The substrate with vermiculite showed better results for both types of containers. The substrate with a higher percentage of sawdust showed the worst result.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.