Toll-like Receptor 4 Activation Promotes Cardiac Arrhythmias By Decreasing The Transient Outward Potassium Current (ito) Through An Irf3-dependent And Myd88-independent Pathway.

Cardiac arrhythmias are one of the main causes of death worldwide. Several studies have shown that inflammation plays a key role in different cardiac diseases and Toll-like receptors (TLRs) seem to be involved in cardiac complications. In the present study, we investigated whether the activation of TLR4 induces cardiac electrical remodeling and arrhythmias, and the signaling pathway involved in these effects. Membrane potential was recorded in Wistar rat ventricle. Ca(2+) transients, as well as the L-type Ca(2+) current (ICaL) and the transient outward K(+) current (Ito), were recorded in isolated myocytes after 24 h exposure to the TLR4 agonist, lipopolysaccharide (LPS, 1 μg/ml). TLR4 stimulation in vitro promoted a cardiac electrical remodeling that leads to action potential prolongation associated with arrhythmic events, such as delayed afterdepolarization and triggered activity. After 24 h LPS incubation, Ito amplitude, as well as Kv4.3 and KChIP2 mRNA levels were reduced. The Ito decrease by LPS was prevented by inhibition of interferon regulatory factor 3 (IRF3), but not by inhibition of interleukin-1 receptor-associated kinase 4 (IRAK4) or nuclear factor kappa B (NF-κB). Extrasystolic activity was present in 25% of the cells, but apart from that, Ca(2+) transients and ICaL were not affected by LPS; however, Na(+)/Ca(2+) exchanger (NCX) activity was apparently increased. We conclude that TLR4 activation decreased Ito, which increased AP duration via a MyD88-independent, IRF3-dependent pathway. The longer action potential, associated with enhanced Ca(2+) efflux via NCX, could explain the presence of arrhythmias in the LPS group.

Chasing Cardiac Physiology And Pathology Down The Camkii Cascade.

Calcium dynamics is central in cardiac physiology, as the key event leading to the excitation-contraction coupling (ECC) and relaxation processes. The primary function of Ca(2+) in the heart is the control of mechanical activity developed by the myofibril contractile apparatus. This key role of Ca(2+) signaling explains the subtle and critical control of important events of ECC and relaxation, such Ca(2+) influx and SR Ca(2+) release and uptake. The multifunctional Ca(2+)-calmodulin-dependent protein kinase II (CaMKII) is a signaling molecule that regulates a diverse array of proteins involved not only in ECC and relaxation, but also in cell death, transcriptional activation of hypertrophy, inflammation and arrhythmias. CaMKII activity is triggered by an increase in intracellular Ca(2+) levels. This activity can be sustained, creating molecular memory after the decline in Ca(2+) concentration, by autophosphorylation of the enzyme, as well as by oxidation, glycosylation and nitrosylation at different sites of the regulatory domain of the kinase. CaMKII activity is enhanced in several cardiac diseases, altering the signaling pathways by which CaMKII regulates the different fundamental proteins involved in functional and transcriptional cardiac processes. Dysregulation of these pathways constitutes a central mechanism of various cardiac disease phenomena, like apoptosis and necrosis during ischemia/reperfusion injury, digitalis exposure, post-acidosis and heart failure arrhythmias, or cardiac hypertrophy. Here we summarize significant aspects of the molecular physiology of CaMKII and provide a conceptual framework for understanding the role of the CaMKII cascade on Ca(2+) regulation and dysregulation in cardiac health and disease.

Cardiac Magnetic Resonance Assessment Of Interstitial Myocardial Fibrosis And Cardiomyocyte Hypertrophy In Hypertensive Mice Treated With Spironolactone.

Nearly 50% of patients with heart failure (HF) have preserved LV ejection fraction, with interstitial fibrosis and cardiomyocyte hypertrophy as early manifestations of pressure overload. However, methods to assess both tissue characteristics dynamically and noninvasively with therapy are lacking. We measured the effects of mineralocorticoid receptor blockade on tissue phenotypes in LV pressure overload using cardiac magnetic resonance (CMR). Mice were randomized to l-nitro-ω-methyl ester (l-NAME, 3 mg/mL in water; n=22), or l-NAME with spironolactone (50 mg/kg/day in subcutaneous pellets; n=21). Myocardial extracellular volume (ECV; marker of diffuse interstitial fibrosis) and the intracellular lifetime of water (τic; marker of cardiomyocyte hypertrophy) were determined by CMR T1 imaging at baseline and after 7 weeks of therapy alongside histological assessments. Administration of l-NAME induced hypertensive heart disease in mice, with increases in mean arterial pressure, LV mass, ECV, and τic compared with placebo-treated controls, while LV ejection fraction was preserved (>50%). In comparison, animals receiving both spironolactone and l-NAME (l-NAME+S) showed less concentric remodeling, and a lower myocardial ECV and τic, indicating decreased interstitial fibrosis and cardiomyocyte hypertrophy (ECV: 0.43 ± 0.09 for l-NAME versus 0.25 ± 0.03 for l-NAME+S, P<0.001; τic: 0.42 ± 0.11 for l-NAME groups versus 0.12 ± 0.05 for l-NAME+S group). Mice treated with a combination of l-NAME and spironolactone were similar to placebo-treated controls at 7 weeks. Spironolactone attenuates interstitial fibrosis and cardiomyocyte hypertrophy in hypertensive heart disease. CMR can phenotype myocardial tissue remodeling in pressure-overload, furthering our understanding of HF progression.

Onset Of Hypertension During Pregnancy Is Associated With Long-term Worse Blood Pressure Control And Adverse Cardiac Remodeling.

Up to 20% of women with hypertensive pregnancy disorders might persist with chronic hypertension. This study compared clinical and echocardiographic features between women whose hypertension began as hypertensive pregnancy disorders (PH group) and women whose diagnosis of hypertension did not occur during pregnancy (NPH group). Fifty PH and 100 NPH women were cross-sectionally evaluated by clinical, laboratory, and echocardiography analysis, and the groups were matched by duration of hypertension. PH exhibited lower age (46.6 ± 1.4 vs. 65.3 ± 1.1 years; P < .001), but higher systolic (159.8 ± 3.9 vs. 148.0 ± 2.5 mm Hg; P = .009) and diastolic (97.1 ± 2.4 vs. 80.9 ± 1.3 mm Hg; P < .001) blood pressure than NPH, although used more antihypertensive classes (3.4 ± 0.2 vs. 2.6 ± 0.1; P < .001). Furthermore, PH showed higher left ventricular wall thickness and increased prevalence of concentric hypertrophy than NPH after adjusting for age and blood pressure. In conclusion, this study showed that PH may exhibit worse blood pressure control and adverse left ventricular remodeling compared with NPH.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.