8 resultados para CL 331002
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Background: Ruthenium (Ru) tetraamines are being increasingly used as nitric oxide (NO) carriers. In this context, pharmacological studies have become highly relevant to better understand the mechanism of action involved. Objective: To evaluate the vascular response of the tetraamines trans-[RuII(NH3)4(Py)(NO)]3+, trans-[RuII(Cl)(NO) (cyclan)](PF6)2, and trans-[RuII(NH3)4(4-acPy)(NO)]3+. Methods: Aortic rings were contracted with noradrenaline (10-6 M). After voltage stabilization, a single concentration (10-6 M) of the compounds was added to the assay medium. The responses were recorded during 120 min. Vascular integrity was assessed functionally using acetylcholine at 10-6 M and sodium nitroprusside at 10-6 M as well as by histological examination. Results: Histological analysis confirmed the presence or absence of endothelial cells in those tissues. All tetraamine complexes altered the contractile response induced by norepinephrine, resulting in increased tone followed by relaxation. In rings with endothelium, the inhibition of endothelial NO caused a reduction of the contractile effect caused by pyridine NO. No significant responses were observed in rings with endothelium after treatment with cyclan NO. In contrast, in rings without endothelium, the inhibition of guanylate cyclase significantly reduced the contractile response caused by the pyridine NO and cyclan NO complexes, and both complexes caused a relaxing effect. Conclusion: The results indicate that the vascular effect of the evaluated complexes involved a decrease in the vascular tone induced by norepinephrine (10-6 M) at the end of the incubation period in aortic rings with and without endothelium, indicating the slow release of NO from these complexes and suggesting that the ligands promoted chemical stability to the molecule. Moreover, we demonstrated that the association of Ru with NO is more stable when the ligands pyridine and cyclan are used in the formulation of the compound.Fundamento: As tetra-aminas de rutênio cada vez mais se destacam como carreadoras da molécula de óxido nítrico. Desse modo, estudos farmacológicos tornam-se altamente relevantes, afim de melhor compreender o mecanismo de ação envolvido. Objetivo: Avaliar a resposta vascular das tetra-aminas trans-[RuII(NH3)4(Py)(NO)]3+, trans-[RuII(Cl)(NO)(Cyclan)](PF6)2 e trans-[RuII(NH3)4(4-acPy)(NO)]3+. Métodos: Anéis de aorta foram pré-contraídos com noradrenalina (10-6M). Após estabilização da tensão, concentração única (10-6M) dos compostos foi adicionada ao banho de incubação. As respostas foram registradas ao longo de 120 minutos. A integridade vascular foi avaliada funcionalmente (acetilcolina 10-6M; nitroprussiato de sódio 10-6M) e histologicamente Resultados: A análise histológica confirmou a presença ou não de células endoteliais nos tecidos analisados. Todos os complexos alteraram a resposta contrátil induzida pela noradrenalina, resultando em aumento de tônus seguido de efeito relaxante. Em anéis com endotélio, a inibição do óxido nítrico endotelial causou redução do efeito contrátil da piridina óxido nítrico. Não foram observadas respostas significativas em anéis com endotélio referente ao composto cyclan óxido nítrico. Por outro lado, em anéis sem endotélio, a inibição da guanilato ciclase reduziu significativamente a resposta contrátil dos complexos piridina óxido nítrico e cyclan óxido nítrico, levando ambos os compostos a um efeito relaxante. Conclusão: Os resultados obtidos demonstram que o efeito vascular dos complexos avaliados apresentaram diminuição no tônus vascular induzido pela noradrenalina (10-6M) ao final do tempo de incubação, em anéis com e sem endotélio, indicando liberação lenta da molécula de óxido nítrico do composto estudado e sugerindo que os ligantes causaram estabilidade química à molécula. Demonstramos que a ligação rutênio óxido nítrico é mais estável quando utilizamos os ligantes piridina e cyclan para a formulação do composto.
Resumo:
Endurance exercise training as well as leucine supplementation modulates glucose homeostasis and protein turnover in mammals. Here, we analyze whether leucine supplementation alters the effects of endurance exercise on these parameters in healthy mice. Mice were distributed into sedentary (C) and exercise (T) groups. The exercise group performed a 12-week swimming protocol. Half of the C and T mice, designated as the CL and TL groups, were supplemented with leucine (1.5 % dissolved in the drinking water) throughout the experiment. As well known, endurance exercise training reduced body weight and the retroperitoneal fat pad, increased soleus mass, increased VO2max, decreased muscle proteolysis, and ameliorated peripheral insulin sensitivity. Leucine supplementation had no effect on any of these parameters and worsened glucose tolerance in both CL and TL mice. In the soleus muscle of the T group, AS-160(Thr-642) (AKT substrate of 160 kDa) and AMPK(Thr-172) (AMP-Activated Protein Kinase) phosphorylation was increased by exercise in both basal and insulin-stimulated conditions, but it was reduced in TL mice with insulin stimulation compared with the T group. Akt phosphorylation was not affected by exercise but was lower in the CL group compared with the other groups. Leucine supplementation increased mTOR phosphorylation at basal conditions, whereas exercise reduced it in the presence of insulin, despite no alterations in protein synthesis. In trained groups, the total FoxO3a protein content and the mRNA for the specific isoforms E2 and E3 ligases were reduced. In conclusion, leucine supplementation did not potentiate the effects of endurance training on protein turnover, and it also reduced its positive effects on glucose homeostasis.
Resumo:
Hypobromous acid (HOBr) is an inorganic acid produced by the oxidation of the bromide anion (Br(-)). The blood plasma level of Br(-) is more than 1,000-fold lower than that of chloride anion (Cl(-)). Consequently, the endogenous production of HOBr is also lower compared to hypochlorous acid (HOCl). Nevertheless, there is much evidence of the deleterious effects of HOBr. From these data, we hypothesized that the reactivity of HOBr could be better associated with its electrophilic strength. Our hypothesis was confirmed, since HOBr was significantly more reactive than HOCl when the oxidability of the studied compounds was not relevant. For instance: anisole (HOBr, k2=2.3×10(2)M(-1)s(-1), HOCl non-reactive); dansylglycine (HOBr, k2=7.3×10(6)M(-1)s(-1), HOCl, 5.2×10(2)M(-1)s(-1)); salicylic acid (HOBr, k2=4.0×10(4)M(-1)s(-1), non-reactive); 3-hydroxybenzoic acid (HOBr, k2=5.9×10(4)M(-1)s(-1), HOCl, k2=1.1×10(1)M(-1)s(-1)); uridine (HOBr, k2=1.3×10(3)M(-1)s(-1), HOCl non-reactive). The compounds 4-bromoanisole and 5-bromouridine were identified as the products of the reactions between HOBr and anisole or uridine, respectively, i.e. typical products of electrophilic substitutions. Together, these results show that, rather than an oxidant, HOBr is a powerful electrophilic reactant. This chemical property was theoretically confirmed by measuring the positive Mulliken and ChelpG charges upon bromine and chlorine. In conclusion, the high electrophilicity of HOBr could be behind its well-established deleterious effects. We propose that HOBr is the most powerful endogenous electrophile.
Resumo:
Women with premature ovarian failure (POF) often manifest complaints involving different aspects of sexual function (SF), regardless of using hormone therapy. SF involves a complex interaction between physical, psychological, and sociocultural aspects. There are doubts about the impact of different complaints on the global context of SF of women with POF. To evaluate the percentage of influence of each of the sexuality domains on the SF in women with POF. Cross-sectional study with 80 women with POF, matched by age to 80 women with normal gonadal function. We evaluated SF through the Female Sexual Function Index (FSFI), a comparison between the POF and control groups using the Mann-Whitney test. Component exploratory factor analysis was used to assess the proportional influence of each domain on the composition of the overall SF for women in the POF group. SF was evaluated using FSFI. Exploratory Factor Analysis for components was used to evaluate the role of each domain on the SF of women with POF. The FSFI score was significantly worse for women with POF, with a decrease in arousal, lubrication, orgasm, satisfaction, and dyspareunia. Exploratory factor analysis of SF showed that the domain with greater influence in the SF was arousal, followed by desire, together accounting for 41% of the FSFI. The domains with less influence were dyspareunia and lubrication, which together accounted for 25% of the FSFI. Women with POF have impaired SF, determined mainly by changes in arousal and desire. Aspects related to lubrication and dyspareunia complaints have lower determination coefficient in SF. These results are important in adapting the approach of sexual disorders in this group of women. Benetti-Pinto CL, Soares PM, Giraldo HPD, and Yela DA. Role of the different sexuality domains on the sexual function of women with premature ovarian failure. J Sex Med 2015;12:685-689.
Resumo:
In this work, we describe a new method for obtaining [Fe(CO)2[(eta5-C5H5)Cl] employing simple techniques and low-cost reagents. It is worth mentioning that this method is faster than others reported in the literature. It was applied in laboratory classes for undergraduate students, exploring different concepts in organometallic chemistry and discussing the steps involved in the synthetic route.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
In 2004, Costa-Santos and cols. reported 24 patients from 19 Brazilian families with 17α-hydroxylase deficiency and showed that p.W406R and p.R362C corresponded to 50% and 32% of CYP17A1 mutant alleles, respectively. The present report describes clinical and molecular data of six patients from three inbred Brazilian families with 17α-hydroxlyse deficiency. All patients had hypogonadism, amenorrhea and hypertension at diagnosis. Two sisters were found to be 46,XY with both gonads palpable in the inguinal region. All patients presented hypergonadotrophic hypogonadism, with high levels of ACTH (> 104 ng/mL), suppressed plasmatic renin activity, low levels of potassium (< 2.8 mEq/L) and elevated progesterone levels (> 4.4 ng/mL). Three of them, including two sisters, were homozygous for p.W406R mutation and the other three (two sisters and one cousin) were homozygous for p.R362C. The finding of p.W406R and p.R362C in the CYP17A1 gene here reported in additional families, confirms them as the most frequent mutations causing complete combined 17α-hydroxylase/17,20-lyase deficiency in Brazilian patients.
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física