8 resultados para Boiler fly ash

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A pterosaur bone bed with at least 47 individuals (wing spans: 0.65-2.35 m) of a new species is reported from southern Brazil from an interdunal lake deposit of a Cretaceous desert, shedding new light on several biological aspects of those flying reptiles. The material represents a new pterosaur, Caiuajara dobruskii gen. et sp. nov., that is the southermost occurrence of the edentulous clade Tapejaridae (Tapejarinae, Pterodactyloidea) recovered so far. Caiuajara dobruskii differs from all other members of this clade in several cranial features, including the presence of a ventral sagittal bony expansion projected inside the nasoantorbital fenestra, which is formed by the premaxillae; and features of the lower jaw, like a marked rounded depression in the occlusal concavity of the dentary. Ontogenetic variation of Caiuajara dobruskii is mainly reflected in the size and inclination of the premaxillary crest, changing from small and inclined (∼ 115°) in juveniles to large and steep (∼ 90°) in adults. No particular ontogenetic features are observed in postcranial elements. The available information suggests that this species was gregarious, living in colonies, and most likely precocial, being able to fly at a very young age, which might have been a general trend for at least derived pterosaurs.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Nutrients composition, phenolic compounds, antioxidant activity and estimated glycemic index (EGI) were evaluated in sorghum bran (SB) and decorticated sorghum flour (DSF), obtained by a rice-polisher, as well as whole sorghum flour (WSF). Correlation between EGI and the studied parameters were determined. SB presented the highest protein, lipid, ash, β-glucan, total and insoluble dietary fiber contents; and the lowest non-resistant and total starch contents. The highest carbohydrate and resistant starch contents were in DSF and WSF, respectively. Phenolic compounds and antioxidant activities were concentrated in SB. The EGI values were: DSF 84.5±0.41; WSF 77.2±0.33; and SB 60.3±0.78. Phenolic compounds, specific flavonoids and antioxidant activities, as well as total, insoluble and soluble dietary fiber and β-glucans of sorghum flour samples were all negatively correlated to EGI. RS content was not correlated to EGI.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This work was done with the objective of studying some physical and mechanical characteristics of the sugarcane bagasse ash added to a soil-cement mixture, in order to obtain an alternative construction material. The sugarcane bagasse ash pre-treatment included both sieving and grinding, before mixing with soil and cement. Different proportions of cement-ash were tested by determining its standard consistence and its compressive resistance at 7 and 28 days age. The various treatments were subsequently applied to the specimens molded with different soil-cement-ash mixtures which in turns were submitted to compaction, unconfined compression and water absorption laboratory tests. The results showed that it is possible to replace up to 20% of Portland cement by sugarcane bagasse ash without any damage to the mixture's compressive strength.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The rice husk and its ash are abundant and renewable and can be used to obtain alternative building materials. An increase in the consumption of such waste could help minimize the environmental problems from their improper disposal. This study aimed to evaluate the use of ashes as a cargo mineral (filler). However, the rice husk chemically interferes in the conduct of the based cement mixtures. Thus, different mixes cement-rice husk with and without the addition of ash were evaluated in order to highlight the influence of its components (husk; ash), which could otherwise be excluded or be underestimated. Cylindrical samples (test of simple compression and traction by diametrical compression) and samples extracted from manufactured pressed board (test of bending and parallel compression to the surface), were used to evaluate the behavior of different mixtures of components (rice hush; RHA - rice husk ahs). The results of the mechanical tests showed, in general, there is not a statistical difference between the mixtures, which are associated with the chemical suppressive effect of the rice husk ash. The mixture of rice husk of 10 mm, with an addition of 35% of the rice husk ash, is notable for allowing the highest consumption of rice husk and rice husk ash, to reduce 25% the consumption of cement and to allow the storage (without emissions to the atmosphere), around 1.9 ton of CO2 per ton of cement consumed, thus contributing to the reduction of CO2 emissions, which can stimulate rural constructions under an ecological point of view.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Rice husk, employed as an energy source at milling industries in Brazil generates, after burning, a dark ash. This residue is not yet conveniently disposed, being currently dumped on large areas, causing environmental problems. This research intended to evaluate the applications of residual rice husk ashes (RHA) as a partial replacement of cement for mortar production. Rice husk ash was chemically characterized through X-ray fluorescence, determination of carbon content, X-ray diffraction, and laser granulometric analysis. Mortar specimens were submitted to two different exposure conditions: internal and external environments at a maximum period of five months. Physical-mechanical testing were compressive strength and ultrasonic pulse velocity (UPV). Although presenting good mechanical performance, the mortar based on ash (RHA) did not present pozolanicity but it can be employed in cement matrices as inert material (filler).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física