12 resultados para Blastomicose sul-americana e supra-renal

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Collection of triatomines in domestic, peridomestic and sylvatic environments in states of Bahia and Rio Grande do Sul, Northeastern and Southern Brazil respectively, and isolation of Trypanosoma cruzi strains. First, the captured triatomines were identified using insect identification keys, then their intestinal content was examined by abdominal compression, and the samples containing trypanosomatid forms were inoculated in LIT medium and Swiss mice. Six triatomine species were collected in cities in Bahia, namely Panstrongylus geniculatus (01), Triatoma melanocephala (11), T. lenti (94), T. pseudomaculata (02), T. sherlocki (26) and T. sordida (460), and two in cities in Rio Grande do Sul, namely T. circummaculata (11) and T. rubrovaria (115). Out of the specimens examined, T. cruzi was isolated from 28 triatomine divided into four different species: T. melanocephala (one), T. lenti (one), T. rubrovaria (16) and T. sordida (10). Their index of natural infection by T. cruzi was 6.4%. The isolation of T. cruzi strains from triatomines found in domestic and peridomestic areas shows the potential risk of transmission of Chagas disease in the studied cities. The maintenance of those T. cruzi strains in laboratory is intended to promote studies that facilitate the understanding of the parasite-vector-host relationship.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Urinary tract infection (UTI) is the most common infection posttransplant. However, the risk factors for and the impact of UTIs remain controversial. The aim of this study was to identify the incidence of posttransplant UTIs in a series of renal transplant recipients from deceased donors. Secondary objectives were to identify: (1) the most frequent infectious agents; (2) risk factors related to donor; (3) risk factors related to recipients; and (4) impact of UTI on graft function. This was a retrospective analysis of medical records from renal transplant patients from January to December 2010. Local ethics committee approved the protocol. The incidence of UTI in this series was 34.2%. Risk factors for UTI were older age, (independent of gender), biopsy-proven acute rejection episodes, and kidneys from deceased donors (United Network for Organ Sharing criteria). For female patients, the number of pretransplant pregnancies was an additional risk factor. Recurrent UTI was observed in 44% of patients from the UTI group. The most common infectious agents were Escherichia coli and Klebsiella pneumoniae, for both isolated and recurrent UTI. No difference in renal graft function or immunosuppressive therapy was observed between groups after the 1-year follow-up. In this series, older age, previous pregnancy, kidneys from expanded criteria donors, and biopsy-proven acute rejection episodes were risk factors for posttransplant UTI. Recurrence of UTI was observed in 44%, with no negative impact on graft function or survival.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

• Microsatellite primers were developed for the tree species Genipa americana (Rubiaceae) for further population genetic studies. • We identified 144 clones containing 65 repeat motifs from a genomic library enriched for (CT)8 and (GT)8 motifs. Primer pairs were developed for 32 microsatellite loci and validated in 40 individuals of two natural G. americana populations. Seventeen loci were polymorphic, revealing from three to seven alleles per locus. The observed and expected heterozygosities ranged from 0.24 to 1.00 and from 0.22 to 0.78, respectively. • The 17 primers identified as polymorphic loci are suitable to study the genetic diversity and structure, mating system, and gene flow in G. americana.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Genipap fruits, native to the Amazon region, were classified in relation to their stage of ripeness according to firmness and peel color. The influence of the part of the genipap fruit and ripeness stage on the iridoid and phenolic compound profiles was evaluated by HPLC-DAD-MS(n), and a total of 17 compounds were identified. Geniposide was the major compound in both parts of the unripe genipap fruits, representing >70% of the total iridoids, whereas 5-caffeoylquinic acid was the major phenolic compound. In ripe fruits, genipin gentiobioside was the major compound in the endocarp (38%) and no phenolic compounds were detected. During ripening, the total iridoid content decreased by >90%, which could explain the absence of blue pigment formation in the ripe fruits after their injury. This is the first time that the phenolic compound composition and iridoid contents of genipap fruits have been reported in the literature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

During the last 30 years many advances have been made in kidney tumor pathology. In 1981, 9 entities were recognized in the WHO Classification. In the latest classification of 2004, 50 different types have been recognized. Additional tumor entities have been described since and a wide variety of prognostic parameters have been investigated with variable success; however, much attention has centered upon the importance of features relating to both stage and grade. The International Society of Urological Pathology (ISUP) recommends after consensus conferences the development of reporting guidelines, which have been adopted worldwide ISUP undertook to review all aspects of the pathology of adult renal malignancy through an international consensus conference to be held in 2012. As in the past, participation in this consensus conference was restricted to acknowledged experts in the field.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Riboflavin (vitamin B2) is a precursor for coenzymes involved in energy production, biosynthesis, detoxification, and electron scavenging. Previously, we demonstrated that irradiated riboflavin (IR) has potential antitumoral effects against human leukemia cells (HL60), human prostate cancer cells (PC3), and mouse melanoma cells (B16F10) through a common mechanism that leads to apoptosis. Hence, we here investigated the effect of IR on 786-O cells, a known model cell line for clear cell renal cell carcinoma (CCRCC), which is characterized by high-risk metastasis and chemotherapy resistance. IR also induced cell death in 786-O cells by apoptosis, which was not prevented by antioxidant agents. IR treatment was characterized by downregulation of Fas ligand (TNF superfamily, member 6)/Fas (TNF receptor superfamily member 6) (FasL/Fas) and tumor necrosis factor receptor superfamily, member 1a (TNFR1)/TNFRSF1A-associated via death domain (TRADD)/TNF receptor-associated factor 2 (TRAF) signaling pathways (the extrinsic apoptosis pathway), while the intrinsic apoptotic pathway was upregulated, as observed by an elevated Bcl-2 associated x protein/B-cell CLL/lymphoma 2 (Bax/Bcl-2) ratio, reduced cellular inhibitor of apoptosis 1 (c-IAP1) expression, and increased expression of apoptosis-inducing factor (AIF). The observed cell death was caspase-dependent as proven by caspase 3 activation and poly(ADP-ribose) polymerase-1 (PARP) cleavage. IR-induced cell death was also associated with downregulation of v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homologue (avian)/protein serine/threonine kinase B/extracellular signal-regulated protein kinase 1/2 (Src/AKT/ERK1/2) pathway and activation of p38 MAP kinase (p38) and Jun-amino-terminal kinase (JNK). Interestingly, IR treatment leads to inhibition of matrix metalloproteinase-2 (MMP-2) activity and reduced expression of renal cancer aggressiveness markers caveolin-1, low molecular weight phosphotyrosine protein phosphatase (LMWPTP), and kinase insert domain receptor (a type III receptor tyrosine kinase) (VEGFR-2). Together, these results show the potential of IR for treating cancer.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Jaguariaiva region is located at Parana State, southern Brazil, and it keeps up the last remnants of savanna vegetation in the State. Thus, it should be considered a mark of the meridional distribution limit of this vegetation type in Brazil. The Parque Estadual do Cerrado (24º09' S; 50º18' WG), whose vegetation is not solely composed by savanna forms, was the object of this study that analysed the vegetation of two dominant savanna physiognomic types (cerrado sensu stricto and campo cerrado). Twenty quadrats of 200m² (20 x 10m) were sistematicaly established in each physiognomic unit, and all the individuals having Basal Perimeter (BP) over 15 cm were sampled. The survey results indicated a low number of woody species in both units (33 species in cerrado sensu stricto and 18 in campo cerrrado). Most important species were virtually the same for both units, specially Byrsonima coccolobifolia, Acosinium subelegans, Couepia grandiflora and Stryphnodendron adstringens. The total density, total dominance and diversity were higher in cerrado sensu stricto. Moreover. there was apparently a higher lloristic resemblance with savannas of São Paulo State, specially those located in the South of thc State.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física