Neonatal Outcomes Of Late Preterm And Early Term Birth.

To compare neonatal deaths and complications in infants born at 34-36 weeks and six days (late preterm: LPT) with those born at term (37-41 weeks and six days); to compare deaths of early term (37-38 weeks) versus late term (39-41 weeks and six days) infants; to search for any temporal trend in LPT rate. A retrospective cohort study of live births was conducted in the Campinas State University, Brazil, from January 2004 to December 2010. Multiple pregnancies, malformations and congenital diseases were excluded. Control for confounders was performed. The level of significance was set at p<0.05. After exclusions, there were 17,988 births (1653 late preterm and 16,345 term infants). A higher mortality in LPT versus term was observed, with an adjusted odds ratio (OR) of 5.29 (p<0.0001). Most complications were significantly associated with LPT births. There was a significant increase in LPT rate throughout the study period, but no significant trend in the rate of medically indicated deliveries. A higher mortality was observed in early term versus late term infants, with adjusted OR: 2.43 (p=0.038). LPT and early term infants have a significantly higher risk of death.

Effects Of Therapeutic Approach On The Neonatal Evolution Of Very Low Birth Weight Infants With Patent Ductus Arteriosus.

To analyze the effects of treatment approach on the outcomes of newborns (birth weight [BW] < 1,000 g) with patent ductus arteriosus (PDA), from the Brazilian Neonatal Research Network (BNRN) on: death, bronchopulmonary dysplasia (BPD), severe intraventricular hemorrhage (IVH III/IV), retinopathy of prematurity requiring surgical (ROPsur), necrotizing enterocolitis requiring surgery (NECsur), and death/BPD. This was a multicentric, cohort study, retrospective data collection, including newborns (BW < 1000 g) with gestational age (GA) < 33 weeks and echocardiographic diagnosis of PDA, from 16 neonatal units of the BNRN from January 1, 2010 to Dec 31, 2011. Newborns who died or were transferred until the third day of life, and those with presence of congenital malformation or infection were excluded. Groups: G1 - conservative approach (without treatment), G2 - pharmacologic (indomethacin or ibuprofen), G3 - surgical ligation (independent of previous treatment). Factors analyzed: antenatal corticosteroid, cesarean section, BW, GA, 5 min. Apgar score < 4, male gender, Score for Neonatal Acute Physiology Perinatal Extension (SNAPPE II), respiratory distress syndrome (RDS), late sepsis (LS), mechanical ventilation (MV), surfactant (< 2 h of life), and time of MV. death, O2 dependence at 36 weeks (BPD36wks), IVH III/IV, ROPsur, NECsur, and death/BPD36wks. Student's t-test, chi-squared test, or Fisher's exact test; Odds ratio (95% CI); logistic binary regression and backward stepwise multiple regression. Software: MedCalc (Medical Calculator) software, version 12.1.4.0. p-values < 0.05 were considered statistically significant. 1,097 newborns were selected and 494 newborns were included: G1 - 187 (37.8%), G2 - 205 (41.5%), and G3 - 102 (20.6%). The highest mortality was observed in G1 (51.3%) and the lowest in G3 (14.7%). The highest frequencies of BPD36wks (70.6%) and ROPsur were observed in G3 (23.5%). The lowest occurrence of death/BPD36wks occurred in G2 (58.0%). Pharmacological (OR 0.29; 95% CI: 0.14-0.62) and conservative (OR 0.34; 95% CI: 0.14-0.79) treatments were protective for the outcome death/BPD36wks. The conservative approach of PDA was associated to high mortality, the surgical approach to the occurrence of BPD36wks and ROPsur, and the pharmacological treatment was protective for the outcome death/BPD36wks.

Contribution Of Antepartum And Intrapartum Hemorrhage To The Burden Of Maternal Near Miss And Death In A National Surveillance Study

Objective To evaluate the occurrence of severe obstetric complications associated with antepartum and intrapartum hemorrhage among women from the Brazilian Network for Surveillance of Severe Maternal Morbidity.Design Multicenter cross-sectional study.Setting Twenty-seven obstetric referral units in Brazil between July 2009 and June 2010.Population A total of 9555 women categorized as having obstetric complications.Methods The occurrence of potentially life-threatening conditions, maternal near miss and maternal deaths associated with antepartum and intrapartum hemorrhage was evaluated. Sociodemographic and obstetric characteristics and the use of criteria for management of severe bleeding were also assessed in these women.Main outcome measures The prevalence ratios with their respective 95% confidence intervals adjusted for the cluster effect of the design, and multiple logistic regression analysis were performed to identify factors independently associated with the occurrence of severe maternal outcome.Results Antepartum and intrapartum hemorrhage occurred in only 8% (767) of women experiencing any type of obstetric complication. However, it was responsible for 18.2% (140) of maternal near miss and 10% (14) of maternal death cases. On multivariate analysis, maternal age and previous cesarean section were shown to be independently associated with an increased risk of severe maternal outcome (near miss or death).Conclusion Severe maternal outcome due to antepartum and intrapartum hemorrhage was highly prevalent among Brazilian women. Certain risk factors, maternal age and previous cesarean delivery in particular, were associated with the occurrence of bleeding.

Hypothermia And Early Neonatal Mortality In Preterm Infants.

To evaluate intervention practices associated with hypothermia at both 5 minutes after birth and at neonatal intensive care unit (NICU) admission and to determine whether hypothermia at NICU admission is associated with early neonatal death in preterm infants. This prospective cohort included 1764 inborn neonates of 22-33 weeks without malformations admitted to 9 university NICUs from August 2010 through April 2012. All centers followed neonatal International Liaison Committee on Resuscitation recommendations for the stabilization and resuscitation in the delivery room (DR). Variables associated with hypothermia (axillary temperature <36.0 °C) 5 minutes after birth and at NICU admission, as well as those associated with early death, were analyzed by logistic regression. Hypothermia 5 minutes after birth and at NICU admission was noted in 44% and 51%, respectively, with 6% of early neonatal deaths. Adjusted for confounding variables, practices associated with hypothermia at 5 minutes after birth were DR temperature <25 °C (OR 2.13, 95% CI 1.67-2.28), maternal temperature at delivery <36.0 °C (OR 1.93, 95% CI 1.49-2.51), and use of plastic bag/wrap (OR 0.53, 95% CI 0.40-0.70). The variables associated with hypothermia at NICU admission were DR temperature <25 °C (OR 1.44, 95% CI 1.10-1.88), respiratory support with cold air in the DR (OR 1.40, 95% CI 1.03-1.88) and during transport to NICU (OR 1.51, 95% CI 1.08-2.13), and cap use (OR 0.55, 95% CI 0.39-0.78). Hypothermia at NICU admission increased the chance of early neonatal death by 1.64-fold (95% CI 1.03-2.61). Simple interventions, such as maintaining DR temperature >25 °C, reducing maternal hypothermia prior to delivery, providing plastic bags/wraps and caps for the newly born infants, and using warm resuscitation gases, may decrease hypothermia at NICU admission and improve early neonatal survival.

Evolution Of The Deaths Registry System In Brazil: Associations With Changes In The Mortality Profile, Under-registration Of Death Counts, And Ill-defined Causes Of Death.

This paper examines the spatial pattern of ill-defined causes of death across Brazilian regions, and its relationship with the evolution of completeness of the deaths registry and changes in the mortality age profile. We make use of the Brazilian Health Informatics Department mortality database and population censuses from 1980 to 2010. We applied demographic methods to evaluate the quality of mortality data for 137 small areas and correct for under-registration of death counts when necessary. The second part of the analysis uses linear regression models to investigate the relationship between, on the one hand, changes in death counts coverage and age profile of mortality, and on the other, changes in the reporting of ill-defined causes of death. The completeness of death counts coverage increases from about 80% in 1980-1991 to over 95% in 2000-2010 at the same time the percentage of ill-defined causes of deaths reduced about 53% in the country. The analysis suggests that the government's efforts to improve data quality are proving successful, and they will allow for a better understanding of the dynamics of health and the mortality transition.

High-resolution Transcript Profiling Of The Atypical Biotrophic Interaction Between Theobroma Cacao And The Fungal Pathogen Moniliophthora Perniciosa.

Witches' broom disease (WBD), caused by the hemibiotrophic fungus Moniliophthora perniciosa, is one of the most devastating diseases of Theobroma cacao, the chocolate tree. In contrast to other hemibiotrophic interactions, the WBD biotrophic stage lasts for months and is responsible for the most distinctive symptoms of the disease, which comprise drastic morphological changes in the infected shoots. Here, we used the dual RNA-seq approach to simultaneously assess the transcriptomes of cacao and M. perniciosa during their peculiar biotrophic interaction. Infection with M. perniciosa triggers massive metabolic reprogramming in the diseased tissues. Although apparently vigorous, the infected shoots are energetically expensive structures characterized by the induction of ineffective defense responses and by a clear carbon deprivation signature. Remarkably, the infection culminates in the establishment of a senescence process in the host, which signals the end of the WBD biotrophic stage. We analyzed the pathogen's transcriptome in unprecedented detail and thereby characterized the fungal nutritional and infection strategies during WBD and identified putative virulence effectors. Interestingly, M. perniciosa biotrophic mycelia develop as long-term parasites that orchestrate changes in plant metabolism to increase the availability of soluble nutrients before plant death. Collectively, our results provide unique insight into an intriguing tropical disease and advance our understanding of the development of (hemi)biotrophic plant-pathogen interactions.

[meanings Of The Sickening Process For Patients With Systemic Lupus Erythematosus: A Review Of The Literature.]

Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.

[evaluation Of Data On Live Birth Certificates From The Information System On Live Births (sinasc) In Campinas, São Paulo, 2009].

To assess the completeness and reliability of the Information System on Live Births (Sinasc) data. A cross-sectional analysis of the reliability and completeness of Sinasc's data was performed using a sample of Live Birth Certificate (LBC) from 2009, related to births from Campinas, Southeast Brazil. For data analysis, hospitals were grouped according to category of service (Unified National Health System, private or both), 600 LBCs were randomly selected and the data were collected in LBC-copies through mothers and newborns' hospital records and by telephone interviews. The completeness of LBCs was evaluated, calculating the percentage of blank fields, and the LBCs agreement comparing the originals with the copies was evaluated by Kappa and intraclass correlation coefficients. The percentage of completeness of LBCs ranged from 99.8%-100%. For the most items, the agreement was excellent. However, the agreement was acceptable for marital status, maternal education and newborn infants' race/color, low for prenatal visits and presence of birth defects, and very low for the number of deceased children. The results showed that the municipality Sinasc is reliable for most of the studied variables. Investments in training of the professionals are suggested in an attempt to improve system capacity to support planning and implementation of health activities for the benefit of maternal and child population.

Reduced Lrp6 Expression And Increase In The Interaction Of Gsk3β With P53 Contribute To Podocyte Apoptosis In Diabetes Mellitus And Are Prevented By Green Tea.

In diabetes mellitus (DM), podocyte apoptosis leads to albuminuria and nephropathy progression. Low-density lipoprotein receptor-related protein 6 (LRP6) is WNT pathway receptor that is involved in podocyte death, adhesion and motility. Glycogen synthase kinase 3 (GSK3) interaction with p53 (GSK3-p53) promotes apoptosis in carcinoma cells. It is unknown if GSK3-p53 contributes to podocyte apoptosis in DM. In experimental DM, green tea (GT) reduces albuminuria by an unknown mechanism. In the present study, we assessed the role of the GSK3β-p53 in podocyte apoptosis and the effects of GT on these abnormalities. In diabetic spontaneously hypertensive rats (SHRs), GT prevents podocyte's p-LRP6 expression reduction, increased GSK3β-p53 and high p53 levels. In diabetic SHR rats, GT reduces podocyte apoptosis, foot process effacement and albuminuria. In immortalized mouse podocytes (iMPs), high glucose (HG), silencing RNA (siRNA) or blocking LRP6 (DKK-1) reduced p-LRP6 expression, leading to high GSK3β-p53, p53 expression, apoptosis and increased albumin influx. GSK3β blockade by BIO reduced GSK3β-p53 and podocyte apoptosis. In iMPs under HG, GT reduced apoptosis and the albumin influx by blocking GSK3β-p53 following the rise in p-LRP6 expression. These effects of GT were prevented by LRP6 siRNA or DKK-1. In conclusion, in DM, WNT inhibition, via LRP6, increases GSK3β-p53 and podocyte apoptosis. Maneuvers that inactivate GSK3β-p53, such as GT, may be renoprotective in DM.

[in Process Citation].

20

Nek5 Interacts With Mitochondrial Proteins And Interferes Negatively In Mitochondrial Mediated Cell Death And Respiration.

Mitochondria are involved in energy supply, signaling, cell death and cellular differentiation and have been implicated in several human diseases. Neks (NIMA-related kinases) represent a family of mammal protein kinases that play essential roles in cell-cycle progression, but other functions have recently been related. A yeast two-hybrid (Y2H) screen was performed to identify and characterize Nek5 interaction partners and the mitochondrial proteins Cox11, MTX-2 and BCLAF1 were retrieved. Apoptosis assay showed protective effects of stable hNek5 expression from Hek293-T's cell death after thapsigargin treatment (2μM). Nek5 silenced cells as well as cells expressing a kinase dead version of Nek5, displayed an increase in ROS formation after 4h of thapsigargin treatment. Mitochondrial respiratory chain activity was found decreased upon stable hNek5expression. Cells silenced for hNek5 on the other hand presented 1.7 fold increased basal rates of respiration, especially at the electrons transfer steps from TMPD to cytochrome c and at the complex II. In conclusion, our data suggest for the first time mitochondrial localization and functions for Nek5 and its participation in cell death and cell respiration regulation. Stable expression of hNek5 in Hek293T cells resulted in enhanced cell viability, decreased cell death and drug resistance, while depletion of hNek5by shRNA overcame cancer cell drug resistance and induced apoptosis in vitro. Stable expression of hNek5 also inhibits thapsigargin promoted apoptosis and the respiratory chain complex IV in HEK293T cells.

Contribution Of Antepartum And Intrapartum Hemorrhage To The Burden Of Maternal Near Miss And Death In A National Surveillance Study.

To evaluate the occurrence of severe obstetric complications associated with antepartum and intrapartum hemorrhage among women from the Brazilian Network for Surveillance of Severe Maternal Morbidity. Multicenter cross-sectional study. Twenty-seven obstetric referral units in Brazil between July 2009 and June 2010. A total of 9555 women categorized as having obstetric complications. The occurrence of potentially life-threatening conditions, maternal near miss and maternal deaths associated with antepartum and intrapartum hemorrhage was evaluated. Sociodemographic and obstetric characteristics and the use of criteria for management of severe bleeding were also assessed in these women. The prevalence ratios with their respective 95% confidence intervals adjusted for the cluster effect of the design, and multiple logistic regression analysis were performed to identify factors independently associated with the occurrence of severe maternal outcome. Antepartum and intrapartum hemorrhage occurred in only 8% (767) of women experiencing any type of obstetric complication. However, it was responsible for 18.2% (140) of maternal near miss and 10% (14) of maternal death cases. On multivariate analysis, maternal age and previous cesarean section were shown to be independently associated with an increased risk of severe maternal outcome (near miss or death). Severe maternal outcome due to antepartum and intrapartum hemorrhage was highly prevalent among Brazilian women. Certain risk factors, maternal age and previous cesarean delivery in particular, were associated with the occurrence of bleeding.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Unusual branching in the palm Euterpe edulis Mart

The unusual development of branches along the stem of Euterpe edulis is described for the first time. Branches originated at 2 to 190 cm from the ground. Ramified individuals and branches were able to produce reproductive structures and some branches produced roots. A plausible cause for the observed anomaly could be genetic problems due to small population sizes. The better agreement of this process can have a positive effect in the harvest of the heart of palm through the artificial induction of sprouts, what would prevent the death of the individual.

O aluno com deficiência visual nas aulas de educação física : análise do processo inclusivo = The student with visual impairments : analysis of inclusive process

Universidade Estadual de Campinas . Faculdade de Educação Física