7 resultados para Biology field

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

60.00% 60.00%

Publicador:

Resumo:

High-throughput screening of physical, genetic and chemical-genetic interactions brings important perspectives in the Systems Biology field, as the analysis of these interactions provides new insights into protein/gene function, cellular metabolic variations and the validation of therapeutic targets and drug design. However, such analysis depends on a pipeline connecting different tools that can automatically integrate data from diverse sources and result in a more comprehensive dataset that can be properly interpreted. We describe here the Integrated Interactome System (IIS), an integrative platform with a web-based interface for the annotation, analysis and visualization of the interaction profiles of proteins/genes, metabolites and drugs of interest. IIS works in four connected modules: (i) Submission module, which receives raw data derived from Sanger sequencing (e.g. two-hybrid system); (ii) Search module, which enables the user to search for the processed reads to be assembled into contigs/singlets, or for lists of proteins/genes, metabolites and drugs of interest, and add them to the project; (iii) Annotation module, which assigns annotations from several databases for the contigs/singlets or lists of proteins/genes, generating tables with automatic annotation that can be manually curated; and (iv) Interactome module, which maps the contigs/singlets or the uploaded lists to entries in our integrated database, building networks that gather novel identified interactions, protein and metabolite expression/concentration levels, subcellular localization and computed topological metrics, GO biological processes and KEGG pathways enrichment. This module generates a XGMML file that can be imported into Cytoscape or be visualized directly on the web. We have developed IIS by the integration of diverse databases following the need of appropriate tools for a systematic analysis of physical, genetic and chemical-genetic interactions. IIS was validated with yeast two-hybrid, proteomics and metabolomics datasets, but it is also extendable to other datasets. IIS is freely available online at: http://www.lge.ibi.unicamp.br/lnbio/IIS/.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Yellowing is an undesirable phenomenon that is common in people with white and grey hair. Because white hair has no melanin, the pigment responsible for hair colour, the effects of photodegradation are more visible in this type of hair. The origin of yellowing and its relation to photodegradation processes are not properly established, and many questions remain open in this field. In this work, the photodegradation of grey hair was investigated as a function of the wavelength of incident radiation, and its ultrastructure was determined, always comparing the results obtained for the white and black fibres present in grey hair with the results of white wool. The results presented herein indicate that the photobehaviour of grey hair irradiated with a mercury lamp or with solar radiation is dependent on the wavelength range of the incident radiation and on the initial shade of yellow in the sample. Two types of grey hair were used: (1) blended grey hair (more yellow) and (2) grey hair from a single-donor (less yellow). After exposure to a full-spectrum mercury lamp for 200 h, the blended white hair turned less yellow (the yellow-blue difference, Db(*) becomes negative, Db(*)=-6), whereas the white hair from the single-donor turned slightly yellower (Db(*)=2). In contrast, VIS+IR irradiation resulted in bleaching in both types of hair, whereas a thermal treatment (at 81 °C) caused yellowing of both types of hair, resulting in a Db(*)=3 for blended white hair and Db(*)=9 for single-donor hair. The identity of the yellow chromophores was investigated by UV-Vis spectroscopy. The results obtained with this technique were contradictory, however, and it was not possible to obtain a simple correlation between the sample shade of yellow and the absorption spectra. In addition, the results are discussed in terms of the morphology differences between the pigmented and non-pigmented parts of grey hair, the yellowing and bleaching effects of grey hair, and the occurrence of dark-follow reactions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Very high field (29)Si-NMR measurements using a fully (29)Si-enriched URu(2)Si(2) single crystal were carried out in order to microscopically investigate the hidden order (HO) state and adjacent magnetic phases in the high field limit. At the lowest measured temperature of 0.4 K, a clear anomaly reflecting a Fermi surface instability near 22 T inside the HO state is detected by the (29)Si shift, (29)K(c). Moreover, a strong enhancement of (29)K(c) develops near a critical field H(c) ≃ 35.6 T, and the ^{29}Si-NMR signal disappears suddenly at H(c), indicating the total suppression of the HO state. Nevertheless, a weak and shifted (29)Si-NMR signal reappears for fields higher than H(c) at 4.2 K, providing evidence for a magnetic structure within the magnetic phase caused by the Ising-type anisotropy of the uranium ordered moments.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Local parity-odd domains are theorized to form inside a quark-gluon plasma which has been produced in high-energy heavy-ion collisions. The local parity-odd domains manifest themselves as charge separation along the magnetic field axis via the chiral magnetic effect. The experimental observation of charge separation has previously been reported for heavy-ion collisions at the top RHIC energies. In this Letter, we present the results of the beam-energy dependence of the charge correlations in Au+Au collisions at midrapidity for center-of-mass energies of 7.7, 11.5, 19.6, 27, 39, and 62.4 GeV from the STAR experiment. After background subtraction, the signal gradually reduces with decreased beam energy and tends to vanish by 7.7 GeV. This implies the dominance of hadronic interactions over partonic ones at lower collision energies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To report on the use of chronic myeloid leukemia as a theme of basic clinical integration for first year medical students to motivate and enable in-depth understanding of the basic sciences of the future physician. During the past thirteen years we have reviewed and updated the curriculum of the medical school of the Universidade Estadual de Campinas. The main objective of the new curriculum is to teach the students how to learn to learn. Since then, a case of chronic myeloid leukemia has been introduced to first year medical students and discussed in horizontal integration with all themes taught during a molecular and cell biology course. Cell structure and components, protein, chromosomes, gene organization, proliferation, cell cycle, apoptosis, signaling and so on are all themes approached during this course. At the end of every topic approached, the students prepare in advance the corresponding topic of clinical cases chosen randomly during the class, which are then presented by them. During the final class, a paper regarding mutations in the abl gene that cause resistance to tyrosine kinase inhibitors is discussed. After each class, three tests are solved in an interactive evaluation. The course has been successful since its beginning, 13 years ago. Great motivation of those who participated in the course was observed. There were less than 20% absences in the classes. At least three (and as many as nine) students every year were interested in starting research training in the field of hematology. At the end of each class, an interactive evaluation was performed and more than 70% of the answers were correct in each evaluation. Moreover, for the final evaluation, the students summarized, in a written report, the molecular and therapeutic basis of chronic myeloid leukemia, with scores ranging from 0 to 10. Considering all 13 years, a median of 78% of the class scored above 5 (min 74%-max 85%), and a median of 67% scored above 7. Chronic myeloid leukemia is an excellent example of a disease that can be used for clinical basic integration as this disorder involves well known protein, cytogenetic and cell function abnormalities, has well-defined diagnostic strategies and a target oriented therapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This survey aimed at describing the interactions of floral visitors and Davilla kunthii A. St.-Hil. as well as characteristics of its reproductive biology in Itacoatiara, state of Amazonas, Brazil. Tests of the breeding system were performed. The guild of visitors was described according to richness, abundance, relative frequency and constancy. The breeding system tests indicated that D. kunthii is self-compatible. The pollination system was characterized as generalist, with 39 visitor species, from three different orders. Bees were the main group of pollinators, thus some behavioural aspects were described. Th e period of highest foraging activity was between 7 and 10 am. Some species presented agonistic and monopolistic behaviour. Given the behaviour and destructive potential, the Curculionidae seem to have a greater impact as seed predators than pollinators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.