7 resultados para Beet and beet sugar.
em Repositório da Produção Científica e Intelectual da Unicamp
Inibidor da ação do etileno na conservação pós-colheita de Chrysanthemum morifolium Ramat cv. Dragon
Resumo:
The durability and postharvest quality of cut flowers are fundamental attributes in value along the production chain and in consumer satisfaction. The objective of this study was to evaluate the effect of chemical inhibitors of ethylene action on maintaining the postharvest quality of chrysanthemum stems (Chrysanthemum morifolium Ramat cv. Dragon). The experiment tested maintenance solutions with silver thiosulfate (STS) under five levels (distilled water, a 0.2 mM STS, the STS 0.2 mM + sucrose at 50 g L-1, STS at 0.4 mM; STS at 0.4 mM + sucrose at 50 g L-1), and date of sampling, for three levels (0, 3, 6 days). Three replications with two flower stems in each treatment were used in the experiment. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, flower color, and number of buds, open flowers and partially open flowers. Treatment with 0.2 mM STS resulted in better maintenance of fresh mass of stems. The concentration of pigments and reducing sugar was higher in those treatments in which sucrose was associated. The color and relative water content were favored in treatments STS 0.2 mM and 0.4 mM. The concentration of 0.2 mM STS obtained the best results, prolonging the vase life the stems. The quality of these stems was higher, with the best assessments of water content, color and turgidity.
Resumo:
Twelve novel 8-hydroxyquinoline derivatives were synthesized with good yields by performing copper-catalyzed Huisgen 1,3-dipolar cycloaddition (click reaction) between an 8-O-alkylated-quinoline containing a terminal alkyne and various aromatic or protected sugar azides. These compounds were evaluated in vitro for their antiproliferative activity on various cancer cell types. Protected sugar derivative 16 was the most active compound in the series, exhibiting potent antiproliferative activity and high selectivity toward ovarian cancer cells (OVCAR-03, GI50 < 0.25 μg mL(-1)); this derivative was more active than the reference drug doxorubicin (OVCAR-03, GI50 = 0.43 μg mL(-1)). In structure-activity relationship (SAR) studies, the physico-chemical parameters of the compounds were evaluated and docking calculations were performed for the α-glucosidase active site to predict the possible mechanism of action of this series of compounds.
Resumo:
The epididymis has an important role in the maturation of sperm for fertilization, but little is known about the epididymal molecules involved in sperm modifications during this process. We have previously described the expression pattern for an antigen in epididymal epithelial cells that reacts with the monoclonal antibody (mAb) TRA 54. Immunohistochemical and immunoblotting analyses suggest that the epitope of the epididymal antigen probably involves a sugar moiety that is released into the epididymal lumen in an androgen-dependent manner and subsequently binds to luminal sperm. Using column chromatography, SDS-PAGE with in situ digestion and mass spectrometry, we have identified the protein recognized by mAb TRA 54 in mouse epididymal epithelial cells. The ∼65 kDa protein is part of a high molecular mass complex (∼260 kDa) that is also present in the sperm acrosomal vesicle and is completely released after the acrosomal reaction. The amino acid sequence of the protein corresponded to that of albumin. Immunoprecipitates with anti-albumin antibody contained the antigen recognized by mAb TRA 54, indicating that the epididymal molecule recognized by mAb TRA 54 is albumin. RT-PCR detected albumin mRNA in the epididymis and fertilization assays in vitro showed that the glycoprotein complex containing albumin was involved in the ability of sperm to recognize and penetrate the egg zona pellucida. Together, these results indicate that epididymal-derived albumin participates in the formation of a high molecular mass glycoprotein complex that has an important role in egg fertilization.
Resumo:
The growth of organs and whole plants depends on both cell growth and cell-cycle progression, but the interaction between both processes is poorly understood. In plants, the balance between growth and cell-cycle progression requires coordinated regulation of four different processes: macromolecular synthesis (cytoplasmic growth), turgor-driven cell-wall extension, mitotic cycle, and endocycle. Potential feedbacks between these processes include a cell-size checkpoint operating before DNA synthesis and a link between DNA contents and maximum cell size. In addition, key intercellular signals and growth regulatory genes appear to target at the same time cell-cycle and cell-growth functions. For example, auxin, gibberellin, and brassinosteroid all have parallel links to cell-cycle progression (through S-phase Cyclin D-CDK and the anaphase-promoting complex) and cell-wall functions (through cell-wall extensibility or microtubule dynamics). Another intercellular signal mediated by microtubule dynamics is the mechanical stress caused by growth of interconnected cells. Superimposed on developmental controls, sugar signalling through the TOR pathway has recently emerged as a central control point linking cytoplasmic growth, cell-cycle and cell-wall functions. Recent progress in quantitative imaging and computational modelling will facilitate analysis of the multiple interconnections between plant cell growth and cell cycle and ultimately will be required for the predictive manipulation of plant growth.
Resumo:
This work assessed the environmental impacts of the production and use of 1 MJ of hydrous ethanol (E100) in Brazil in prospective scenarios (2020-2030), considering the deployment of technologies currently under development and better agricultural practices. The life cycle assessment technique was employed using the CML method for the life cycle impact assessment and the Monte Carlo method for the uncertainty analysis. Abiotic depletion, global warming, human toxicity, ecotoxicity, photochemical oxidation, acidification, and eutrophication were the environmental impacts categories analyzed. Results indicate that the proposed improvements (especially no-til farming-scenarios s2 and s4) would lead to environmental benefits in prospective scenarios compared to the current ethanol production (scenario s0). Combined first and second generation ethanol production (scenarios s3 and s4) would require less agricultural land but would not perform better than the projected first generation ethanol, although the uncertainties are relatively high. The best use of 1 ha of sugar cane was also assessed, considering the displacement of the conventional products by ethanol and electricity. No-til practices combined with the production of first generation ethanol and electricity (scenario s2) would lead to the largest mitigation effects for global warming and abiotic depletion. For the remaining categories, emissions would not be mitigated with the utilization of the sugar cane products. However, this conclusion is sensitive to the displaced electricity sources.
Resumo:
Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.