10 resultados para Bacterial Fruit Blotch

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mine drainage is an important environmental disturbance that affects the chemical and biological components in natural resources. However, little is known about the effects of neutral mine drainage on the soil bacteria community. Here, a high-throughput 16S rDNA pyrosequencing approach was used to evaluate differences in composition, structure, and diversity of bacteria communities in samples from a neutral drainage channel, and soil next to the channel, at the Sossego copper mine in Brazil. Advanced statistical analyses were used to explore the relationships between the biological and chemical data. The results showed that the neutral mine drainage caused changes in the composition and structure of the microbial community, but not in its diversity. The Deinococcus/Thermus phylum, especially the Meiothermus genus, was in large part responsible for the differences between the communities, and was positively associated with the presence of copper and other heavy metals in the environmental samples. Other important parameters that influenced the bacterial diversity and composition were the elements potassium, sodium, nickel, and zinc, as well as pH. The findings contribute to the understanding of bacterial diversity in soils impacted by neutral mine drainage, and demonstrate that heavy metals play an important role in shaping the microbial population in mine environments.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Biofilm formation on reverse osmosis (RO) systems represents a drawback in the application of this technology by different industries, including oil refineries. In RO systems the feed water maybe a source of microbial contamination and thus contributes for the formation of biofilm and consequent biofouling. In this study the planktonic culturable bacterial community was characterized from a feed water of a RO system and their capacities were evaluated to form biofilm in vitro. Bacterial motility and biofilm control were also analysed using phages. As results, diverse Protobacteria, Actinobacteria and Bacteroidetes were identified. Alphaproteobacteria was the predominant group and Brevundimonas, Pseudomonas and Mycobacterium the most abundant genera. Among the 30 isolates, 11 showed at least one type of motility and 11 were classified as good biofilm formers. Additionally, the influence of non-specific bacteriophage in the bacterial biofilms formed in vitro was investigated by action of phages enzymes or phage infection. The vB_AspP-UFV1 (Podoviridae) interfered in biofilm formation of most tested bacteria and may represent a good alternative in biofilm control. These findings provide important information about the bacterial community from the feed water of a RO system that may be used for the development of strategies for biofilm prevention and control in such systems.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mining activities pose severe environmental risks worldwide, generating extreme pH conditions and high concentrations of heavy metals, which can have major impacts on the survival of organisms. In this work, pyrosequencing of the V3 region of the 16S rDNA was used to analyze the bacterial communities in soil samples from a Brazilian copper mine. For the analysis, soil samples were collected from the slopes (geotechnical structures) and the surrounding drainage of the Sossego mine (comprising the Sossego and Sequeirinho deposits). The results revealed complex bacterial diversity, and there was no influence of deposit geographic location on the composition of the communities. However, the environment type played an important role in bacterial community divergence; the composition and frequency of OTUs in the slope samples were different from those of the surrounding drainage samples, and Acidobacteria, Chloroflexi, Firmicutes, and Gammaproteobacteria were responsible for the observed difference. Chemical analysis indicated that both types of sample presented a high metal content, while the amounts of organic matter and water were higher in the surrounding drainage samples. Non-metric multidimensional scaling (N-MDS) analysis identified organic matter and water as important distinguishing factors between the bacterial communities from the two types of mine environment. Although habitat-specific OTUs were found in both environments, they were more abundant in the surrounding drainage samples (around 50 %), and contributed to the higher bacterial diversity found in this habitat. The slope samples were dominated by a smaller number of phyla, especially Firmicutes. The bacterial communities from the slope and surrounding drainage samples were different in structure and composition, and the organic matter and water present in these environments contributed to the observed differences.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Type IV secretion systems (T4SSs) are multiprotein complexes that transport effector proteins and protein-DNA complexes through bacterial membranes to the extracellular milieu or directly into the cytoplasm of other cells. Many bacteria of the family Xanthomonadaceae, which occupy diverse environmental niches, carry a T4SS with unknown function but with several characteristics that distinguishes it from other T4SSs. Here we show that the Xanthomonas citri T4SS provides these cells the capacity to kill other Gram-negative bacterial species in a contact-dependent manner. The secretion of one type IV bacterial effector protein is shown to require a conserved C-terminal domain and its bacteriolytic activity is neutralized by a cognate immunity protein whose 3D structure is similar to peptidoglycan hydrolase inhibitors. This is the first demonstration of the involvement of a T4SS in bacterial killing and points to this special class of T4SS as a mediator of both antagonistic and cooperative interbacterial interactions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present work aimed to investigate the diversity of bacteria and filamentous fungi of southern Atlantic Ocean marine sponge Dragmacidon reticulatum using cultivation-independent approaches. Fungal ITS rDNA and 18S gene analyses (DGGE and direct sequencing approaches) showed the presence of representatives of three order (Polyporales, Malasseziales, and Agaricales) from the phylum Basidiomycota and seven orders belonging to the phylum Ascomycota (Arthoniales, Capnodiales, Dothideales, Eurotiales, Hypocreales, Pleosporales, and Saccharomycetales). On the other hand, bacterial 16S rDNA gene analyses by direct sequencing approach revealed the presence of representatives of seven bacterial phyla (Cyanobacteria, Proteobacteria, Actinobacteria, Bacteroidetes, Lentisphaerae, Chloroflexi, and Planctomycetes). Results from statistical analyses (rarefaction curves) suggested that the sampled clones covered the fungal diversity in the sponge samples studied, while for the bacterial community additional sampling would be necessary for saturation. This is the first report related to the molecular analyses of fungal and bacterial communities by cultivation-independent approaches in the marine sponges D. reticulatum. Additionally, the present work broadening the knowledge of microbial diversity associated to marine sponges and reports innovative data on the presence of some fungal genera in marine samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.