12 resultados para BETA DETECTION
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
This clinical study has investigated the antigenic activity of bacterial contents from exudates of acute apical abscesses (AAAs) and their paired root canal contents regarding the stimulation capacity by levels of interleukin (IL)-1 beta and tumor necrosis factor alpha (TNF-α) throughout the root canal treatment against macrophage cells. Paired samples of infected root canals and exudates of AAAs were collected from 10 subjects. Endodontic contents were sampled before (root canal sample [RCS] 1) and after chemomechanical preparation (RCS2) and after 30 days of intracanal medication with calcium hydroxide + chlorhexidine gel (Ca[OH]2 + CHX gel) (RCS3). Polymerase chain reaction (16S rDNA) was used for detection of the target bacteria, whereas limulus amebocyte lysate was used to measure endotoxin levels. Raw 264.7 macrophages were stimulated with AAA exudates from endodontic contents sampled in different moments of root canal treatment. Enzyme-linked immunosorbent assays were used to measure the levels of TNF-α and IL-1 beta. Parvimonas micra, Porphyromonas endodontalis, Dialister pneumosintes, and Prevotella nigrescens were the most frequently detected species. Higher levels of endotoxins were found in samples from periapical exudates at RCS1 (P < .005). In fact, samples collected from periapical exudates showed a higher stimulation capacity at RCS1 (P < .05). A positive correlation was found between endotoxins from exudates with IL-1 beta (r = 0.97) and TNF-α (r = 0.88) production (P < .01). The significant reduction of endotoxins and bacterial species achieved by chemomechanical procedures (RCS2) resulted in a lower capacity of root canal contents to stimulate the cells compared with that at RCS1 (P < .05). The use of Ca(OH)2 + CHX gel as an intracanal medication (RCS3) improved the removal of endotoxins and bacteria from infected root canals (P < .05) whose contents induced a lower stimulation capacity against macrophages cells at RCS1, RCS2, and RCS3 (P < .05). AAA exudates showed higher levels of endotoxins and showed a greater capacity of macrophage stimulation than the paired root canal samples. Moreover, the use of intracanal medication improved the removal of bacteria and endotoxins from infected root canals, which may have resulted in the reduction of the inflammatory potential of the root canal content.
Resumo:
In this study, we investigated the effect of low density lipoprotein receptor (LDLr) deficiency on gap junctional connexin 36 (Cx36) islet content and on the functional and growth response of pancreatic beta-cells in C57BL/6 mice fed a high-fat (HF) diet. After 60 days on regular or HF diet, the metabolic state and morphometric islet parameters of wild-type (WT) and LDLr-/- mice were assessed. HF diet-fed WT animals became obese and hypercholesterolaemic as well as hyperglycaemic, hyperinsulinaemic, glucose intolerant and insulin resistant, characterizing them as prediabetic. Also they showed a significant decrease in beta-cell secretory response to glucose. Overall, LDLr-/- mice displayed greater susceptibility to HF diet as judged by their marked cholesterolaemia, intolerance to glucose and pronounced decrease in glucose-stimulated insulin secretion. HF diet induced similarly in WT and LDLr-/- mice, a significant decrease in Cx36 beta-cell content as revealed by immunoblotting. Prediabetic WT mice displayed marked increase in beta-cell mass mainly due to beta-cell hypertrophy/replication. Nevertheless, HF diet-fed LDLr-/- mice showed no significant changes in beta-cell mass, but lower islet-duct association (neogenesis) and higher beta-cell apoptosis index were seen as compared to controls. The higher metabolic susceptibility to HF diet of LDLr-/- mice may be explained by a deficiency in insulin secretory response to glucose associated with lack of compensatory beta-cell expansion.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
Obesity is associated with insulin resistance and is known to be a risk factor for type-2 diabetes. In obese individuals, pancreatic beta-cells try to compensate for the increased insulin demand in order to maintain euglycemia. Most studies have reported that this adaptation is due to morphological changes. However, the involvement of beta-cell functional adaptations in this process needs to be clarified. For this purpose, we evaluated different key steps in the glucose-stimulated insulin secretion (GSIS) in intact islets from female ob/ob obese mice and lean controls. Obese mice showed increased body weight, insulin resistance, hyperinsulinemia, glucose intolerance and fed hyperglycemia. Islets from ob/ob mice exhibited increased glucose-induced mitochondrial activity, reflected by enhanced NAD(P)H production and mitochondrial membrane potential hyperpolarization. Perforated patch-clamp examination of beta-cells within intact islets revealed several alterations in the electrical activity such as increased firing frequency and higher sensitivity to low glucose concentrations. A higher intracellular Ca(2+) mobilization in response to glucose was also found in ob/ob islets. Additionally, they displayed a change in the oscillatory pattern and Ca(2+) signals at low glucose levels. Capacitance experiments in intact islets revealed increased exocytosis in individual ob/ob beta-cells. All these up-regulated processes led to increased GSIS. In contrast, we found a lack of beta-cell Ca(2+) signal coupling, which could be a manifestation of early defects that lead to beta-cell malfunction in the progression to diabetes. These findings indicate that beta-cell functional adaptations are an important process in the compensatory response to obesity.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
6
Resumo:
Characteriza of the inclusion complex ropivacaine: beta-cyclodextrin. Ropivacaine (RVC) is a widely used local anesthetic. The complexation of RVC with beta-cyclodextrin (beta-CD) is of great interest for the development of more efficient local anesthetic formulations. The present work focuses on the characterization of the RVC:beta-CD complex by nuclear magnetic resonance (NMR). The stoichiometry of the complex is 1:2 RVC:beta-CD. DOSY-NMR shows that the association constant is 55.5 M-1. Longitudinal relaxation time results show that RVC changes its mobility in the presence of beta-CD. This study is focused on the physicochemical characterization of inclusion complexes that are potentials options for pain treatment.
Resumo:
High levels of substrate-based 1,5-stereoinduction are obtained in the boron-mediated aldol reactions of beta-oxygenated methyl ketones with achiral and chiral aldehydes. Remote induction from the boron enolates gives the 1,5-anti adducts, with the enolate pi-facial selectivity critically dependent upon the nature of the beta-alkoxy protecting group. This 1,5-anti aldol methodology has been strategically employed in the total synthesis of several natural products. At present, the origin of the high level of 1,5-anti induction obtained with the boron enolates is unclear, although a model based on a hydrogen bonding between the alkoxy oxygen and the formyl hydrogen has been recently proposed.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.