Doehlert Design-desirability Function Multi-criteria Optimal Separation Of 17 Phenolic Compounds From Extra-virgin Olive Oil By Capillary Zone Electrophoresis.

In Brazil, the consumption of extra-virgin olive oil (EVOO) is increasing annually, but there are no experimental studies concerning the phenolic compound contents of commercial EVOO. The aim of this work was to optimise the separation of 17 phenolic compounds already detected in EVOO. A Doehlert matrix experimental design was used, evaluating the effects of pH and electrolyte concentration. Resolution, runtime and migration time relative standard deviation values were evaluated. Derringer's desirability function was used to simultaneously optimise all 37 responses. The 17 peaks were separated in 19min using a fused-silica capillary (50μm internal diameter, 72cm of effective length) with an extended light path and 101.3mmolL(-1) of boric acid electrolyte (pH 9.15, 30kV). The method was validated and applied to 15 EVOO samples found in Brazilian supermarkets.

Remediation Of 17-α-ethinylestradiol Aqueous Solution By Photocatalysis And Electrochemically-assisted Photocatalysis Using Tio2 And Tio2/wo3 Electrodes Irradiated By A Solar Simulator.

TiO2 and TiO2/WO3 electrodes, irradiated by a solar simulator in configurations for heterogeneous photocatalysis (HP) and electrochemically-assisted HP (EHP), were used to remediate aqueous solutions containing 10 mg L(-1) (34 μmol L(-1)) of 17-α-ethinylestradiol (EE2), active component of most oral contraceptives. The photocatalysts consisted of 4.5 μm thick porous films of TiO2 and TiO2/WO3 (molar ratio W/Ti of 12%) deposited on transparent electrodes from aqueous suspensions of TiO2 particles and WO3 precursors, followed by thermal treatment at 450 (°)C. First, an energy diagram was organized with photoelectrochemical and UV-Vis absorption spectroscopy data and revealed that EE2 could be directly oxidized by the photogenerated holes at the semiconductor surfaces, considering the relative HOMO level for EE2 and the semiconductor valence band edges. Also, for the irradiated hybrid photocatalyst, electrons in TiO2 should be transferred to WO3 conduction band, while holes move toward TiO2 valence band, improving charge separation. The remediated EE2 solutions were analyzed by fluorescence, HPLC and total organic carbon measurements. As expected from the energy diagram, both photocatalysts promoted the EE2 oxidation in HP configuration; after 4 h, the EE2 concentration decayed to 6.2 mg L(-1) (35% of EE2 removal) with irradiated TiO2 while TiO2/WO3 electrode resulted in 45% EE2 removal. A higher performance was achieved in EHP systems, when a Pt wire was introduced as a counter-electrode and the photoelectrodes were biased at +0.7 V; then, the EE2 removal corresponded to 48 and 54% for the TiO2 and TiO2/WO3, respectively. The hybrid TiO2/WO3, when compared to TiO2 electrode, exhibited enhanced sunlight harvesting and improved separation of photogenerated charge carriers, resulting in higher performance for removing this contaminant of emerging concern from aqueous solution.

Intraductal Carcinoma Of The Prostate: Interobserver Reproducibility Survey Of 39 Urologic Pathologists.

The diagnosis of intraductal carcinoma (IDC) of the prostate remains subjective because 3 sets of diagnostic criteria are in use. An internet survey was compiled from 38 photomicrographs showing duct proliferations: 14 signed out as high-grade prostatic intraepithelial neoplasia (HGPIN), 17 IDC, and 7 invasive cribriform/ductal carcinoma. Each image was assessed for the presence of 9 histologic criteria ascribed to IDC. Thirty-nine respondents were asked to rate images as (1) benign/reactive, (2) HGPIN, (3) borderline between HGPIN and IDC, (4) IDC, or (5) invasive cribriform/ductal carcinoma. Intraclass correlation coefficient was 0.68. There was 70% overall agreement with HGPIN, 43% with IDC, and 73% with invasive carcinoma (P < .001, χ(2)). Respondents considered 19 (50%) of 38 cases as IDC candidates, of which 5 (26%) had a two-thirds consensus for IDC; two-thirds consensus for either borderline or IDC was reached in 9 (47%). Two-thirds consensus other than IDC was reached in the remaining 19 of 38 cases, with 15 supporting HGPIN and 4 supporting invasive carcinoma. Findings that differed across diagnostic categories were lumen-spanning neoplastic cells (P < .001), 2× benign duct diameters (P < .001), duct space contours (round, irregular, and branched) (P < .001), papillary growth (P = .048), dense cribriform or solid growth (both P = .023), and comedonecrosis (P = .015). When the 19 of 38 images that attained consensus for HGPIN or invasive carcinoma were removed from consideration, lack of IDC consensus was most often attributable to only loose cribriform growth (5/19), central nuclear maturation (5/19), or comedonecrosis (3/19). Of the 9 histologic criteria, only 1 retained significant correlation with a consensus diagnosis of IDC: the presence of solid areas (P = .038). One case that attained IDC consensus had less than 2× duct enlargement yet still had severe nuclear atypia and nucleomegaly. Six fold nuclear enlargement was not significant (P = .083), although no image had both 6× nuclei and papillary or loose cribriform growth: a combination postulated as sufficient criteria for IDC. Finally, 20.5% of respondents agreed that an isolated diagnosis of IDC on needle biopsy warrants definitive therapy, 20.5% disagreed, and 59.0% considered the decision to depend upon clinicopathologic variables. Although IDC diagnosis remains challenging, we propose these criteria: a lumen-spanning proliferation of neoplastic cells in preexisting ducts with a dense cribriform or partial solid growth pattern. Solid growth, in any part of the duct space, emerges as the most reproducible finding to rule in a diagnosis of IDC. Comedonecrosis is a rarer finding, but in most cases, it should rule in IDC. Duct space enlargement to greater than 2× the diameter of the largest, adjacent benign spaces is usually present in IDC, although there may be rare exceptions.

Estudo dos efeitos de temporada de treinamento físico sobre a Performance de uma equipe de handebol feminino sub-21

Handball is a sport that demands endurance associated with fast and powerful actions such as jumps, blocks, sprints and throws. The aim of this study was to evaluate the effects of a 38-week systematic physical training applied to a women's under 21 handball team on upper and lower limb power, 30m sprints speed and endurance. The periodization applied was an adaptation of the Verkhoshansky theory, and aimed at two performance peaks during the season with six data collections. The median and range values for three kg medicine ball throwing was: 2.98m (2.15-3.50); 2.84m (2.43-3.20); 2.90m (2.60-3.38); 3.10 (2.83-3.81); 2.84 (2.55-3.57) and 3.34 (2.93-3.83). Regarding the three-pass running test: 5.60m (4.93-6.58); 5.37m (5.04-6.38); 5.36m (4.93-6.12); 5.65m (4.80-6.78); 5.63m (5.00-6.40) and 5.83m (5.14-6.05). Regarding the 30-m sprint test: 5.8m/s (5.45-6.44); 6,64 m/s (6,24-7,09); 5.65m/s (5.17-5.95); (there was not IV moment for this test); 6.19 m/s (5.57-6.26) and 5.83 (5.14-6.05).Regarding the 30-m sprint endurance test until 10% decrease: 4 sprints (4-6); 5 sprints (4-9); 4,5 sprints (4-16); (there was not IV moment for this test); 6 sprints (4-12) and 5 sprints (4-5). Significant differences (p<0.05) were observed in three kg medicine ball throwing and three-pass running tests at least in one of the performance peak planned, with no significant differences in 30-m sprint speed or endurance tests. The applied physical training was efficient at improving the specific physical fitness in the performance peaks, as well as giving support for better physical training adjustment for the upcoming season.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Six new cases confirm the clinical molecular profile of complete combined 17α-hydroxylase/ 17,20-lyase deficiency in Brazil

In 2004, Costa-Santos and cols. reported 24 patients from 19 Brazilian families with 17α-hydroxylase deficiency and showed that p.W406R and p.R362C corresponded to 50% and 32% of CYP17A1 mutant alleles, respectively. The present report describes clinical and molecular data of six patients from three inbred Brazilian families with 17α-hydroxlyse deficiency. All patients had hypogonadism, amenorrhea and hypertension at diagnosis. Two sisters were found to be 46,XY with both gonads palpable in the inguinal region. All patients presented hypergonadotrophic hypogonadism, with high levels of ACTH (> 104 ng/mL), suppressed plasmatic renin activity, low levels of potassium (< 2.8 mEq/L) and elevated progesterone levels (> 4.4 ng/mL). Three of them, including two sisters, were homozygous for p.W406R mutation and the other three (two sisters and one cousin) were homozygous for p.R362C. The finding of p.W406R and p.R362C in the CYP17A1 gene here reported in additional families, confirms them as the most frequent mutations causing complete combined 17α-hydroxylase/17,20-lyase deficiency in Brazilian patients.

Analise das ações de jogos de voleibol e suas implicações para o treinamento tecnico-tatico da categoria infanto-juvenil feminina(16 e 17 anos)

Universidade Estadual de Campinas. Faculdade de Educação Física