Lawsonia Inermis-mediated Synthesis Of Silver Nanoparticles: Activity Against Human Pathogenic Fungi And Bacteria With Special Reference To Formulation Of An Antimicrobial Nanogel.

Lawsonia inermis mediated synthesis of silver nanoparticles (Ag-NPs) and its efficacy against Candida albicans, Microsporum canis, Propioniabacterium acne and Trichophyton mentagrophytes is reported. A two-step mechanism has been proposed for bioreduction and formation of an intermediate complex leading to the synthesis of capped nanoparticles was developed. In addition, antimicrobial gel for M. canis and T. mentagrophytes was also formulated. Ag-NPs were synthesized by challenging the leaft extract of L. inermis with 1 mM AgNO₃. The Ag-NPs were characterized by Ultraviolet-Visible (UV-Vis) spectrophotometer and Fourier transform infrared spectroscopy (FTIR). Transmission electron microscopy (TEM), nanoparticle tracking and analysis sytem (NTA) and zeta potential was measured to detect the size of Ag-NPs. The antimicrobial activity of Ag-NPs was evaluated by disc diffusion method against the test organisms. Thus these Ag-NPs may prove as a better candidate drug due to their biogenic nature. Moreover, Ag-NPs may be an answer to the drug-resistant microorganisms.

Antimicrobial And Antiproliferative Potential Of Anadenanthera Colubrina (vell.) Brenan.

The aim of the present study was to perform an in vitro analysis of the antimicrobial and antiproliferative potential of an extract from Anadenanthera colubrina (Vell.) Brenan (angico) and chemically characterize the crude extract. Antimicrobial action was evaluated based on the minimum inhibitory concentration (MIC), minimum bactericidal/fungicidal concentration, and the inhibition of formation to oral biofilm. Cell morphology was determined through scanning electron microscopy (SEM). Six strains of tumor cells were used for the determination of antiproliferative potential. The extract demonstrated strong antifungal activity against Candida albicans ATCC 18804 (MIC = 0.031 mg/mL), with similar activity found regarding the ethyl acetate fraction. The extract and active fraction also demonstrated the capacity to inhibit the formation of Candida albicans to oral biofilm after 48 hours, with median values equal to or greater than the control group, but the difference did not achieve statistical significance (P > 0.05). SEM revealed alterations in the cell morphology of the yeast. Regarding antiproliferative activity, the extract demonstrated cytostatic potential in all strains tested. The present findings suggest strong antifungal potential for Anadenanthera colubrina (Vell.) Brenan as well as a tendency toward diminishing the growth of human tumor cells.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Dentine Bond Strength And Antimicrobial Activity Evaluation Of Adhesive Systems.

This study evaluated the dentine bond strength (BS) and the antibacterial activity (AA) of six adhesives against strict anaerobic and facultative bacteria. Three adhesives containing antibacterial components (Gluma 2Bond (glutaraldehyde)/G2B, Clearfil SE Protect (MDPB)/CSP and Peak Universal Bond (PUB)/chlorhexidine) and the same adhesive versions without antibacterial agents (Gluma Comfort Bond/GCB, Clearfil SE Bond/CSB and Peak LC Bond/PLB) were tested. The AA of adhesives and control groups was evaluated by direct contact method against four strict anaerobic and four facultative bacteria. After incubation, according to the appropriate periods of time for each microorganism, the time to kill microorganisms was measured. For BS, the adhesives were applied according to manufacturers' recommendations and teeth restored with composite. Teeth (n=10) were sectioned to obtain bonded beams specimens, which were tested after artificial saliva storage for one week and one year. BS data were analyzed using two-way ANOVA and Tukey test. Saliva storage for one year reduces the BS only for GCB. In general G2B and GCB required at least 24h for killing microorganisms. PUB and PLB killed only strict anaerobic microorganisms after 24h. For CSP the average time to eliminate the Streptococcus mutans and strict anaerobic oral pathogens was 30min. CSB showed no AA against facultative bacteria, but had AA against some strict anaerobic microorganisms. Storage time had no effect on the BS for most of the adhesives. The time required to kill bacteria depended on the type of adhesive and never was less than 10min. Most of the adhesives showed stable bond strength after one year and the Clearfil SE Protect may be a good alternative in restorative procedures performed on dentine, considering its adequate bond strength and better antibacterial activity.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Photodynamic Antimicrobial Effects Of Bis-indole Alkaloid Indigo From Indigofera Truxillensis Kunth (leguminosae).

Multidrug-resistant microbial infections represent an exponentially growing problem affecting communities worldwide. Photodynamic therapy is a promising treatment based on the combination of light, oxygen, and a photosensitizer that leads to reactive oxygen species production, such as superoxide (type I mechanism) and singlet oxygen (type II mechanism) that cause massive oxidative damage and consequently the host cell death. Indigofera genus has gained considerable interest due its mutagenic, cytotoxic, and genotoxic activity. Therefore, this study was undertaken to investigate the effect of crude extracts, alkaloidal fraction, and isolated substance derived from Indigofera truxillensis in photodynamic antimicrobial chemotherapy on the viability of bacteria and yeast and evaluation of mechanisms involved. Our results showed that all samples resulted in microbial photoactivation in subinhibitory concentration, with indigo alkaloid presenting a predominant photodynamic action through type I mechanism. The use of CaCl2 and MgCl2 as cell permeabilizing additives also increased gram-negative bacteria susceptibility to indigo.

Photocatalytic Degradation Of Ofloxacin And Evaluation Of The Residual Antimicrobial Activity.

Ofloxacin is an antimicrobial agent frequently found in significant concentrations in wastewater and surface water. Its continuous introduction into the environment is a potential risk to non-target organisms or to human health. In this study, ofloxacin degradation by UV/TiO2 and UV/TiO2/H2O2, antimicrobial activity (E. coli) of samples subjected to these processes, and by-products formed were evaluated. For UV/TiO2, the degradation efficiency was 89.3% in 60 min of reaction when 128 mg L(-1) TiO2 were used. The addition of 1.68 mmol L(-1) hydrogen peroxide increased degradation to 97.8%. For UV/TiO2, increasing the catalyst concentration from 4 to 128 mg L(-1) led to an increase in degradation efficiency. For both processes, the antimicrobial activity was considerably reduced throughout the reaction time. The structures of two by-products are presented: m/z 291 (9-fluoro-3-methyl-10-(methyleneamino)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid) and m/z 157 ((Z)-2-formyl-3-((2-oxoethyl)imino)propanoic acid).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.