7 resultados para Antenas banda larga
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
This paper describes the development of a relational database and a tool for viewing MODIS NDVI temporal profile, using data from MOD09Q1 product, specifically the surface bidirectional reflectance factor relative to the RED and NIR wavelength, mosaic of 8-day temporal composition, and the quality band, in sugarcane fields in the state of São Paulo, for analysis of the late stubble-cane maturation. From sugarcane farms were obtained the historical data about yield, soil, variety, location of the each pixel for each subregion monitored. All data were integrated in a database developed in PostgreSQL. The tool was implemented using Java language and allowed a fast and automatic way of analyzing sugarcane phenological patterns. It concluded that the MODIS NDVI temporal profile using data from MOD09Q1 product is able to subsidize the monitoring of phenological changes in the sugarcane.
Resumo:
cDNA arrays are a powerful tool for discovering gene expression patterns. Nylon arrays have the advantage that they can be re-used several times. A key issue in high throughput gene expression analysis is sensitivity. In the case of nylon arrays, signal detection can be affected by the plastic bags used to keep membranes humid. In this study, we evaluated the effect of five types of plastics on the radioactive transmittance, number of genes with a signal above the background, and data variability. A polyethylene plastic bag 69 μm thick had a strong shielding effect that blocked 68.7% of the radioactive signal. The shielding effect on transmittance decreased the number of detected genes and increased the data variability. Other plastics which were thinner gave better results. Although plastics made from polyvinylidene chloride, polyvinyl chloride (both 13 μm thick) and polyethylene (29 and 7 μm thick) showed different levels of transmittance, they all gave similarly good performances. Polyvinylidene chloride and polyethylene 29 mm thick were the plastics of choice because of their easy handling. For other types of plastics, it is advisable to run a simple check on their performance in order to obtain the maximum information from nylon cDNA arrays.
Resumo:
Cecropia glaziovii is a tree with used in Brazilian popular medicine. Methods allowing the clonal propagation of this species are of great interest for superior genotype multiplication and perpetuation. For this reason, we examined the effect of different culture media and different types of explants on adventitious shoot regeneration from callus and buds of C. glaziovii. Leaves, petioles and stipules obtained from aseptically grown seedlings or from pre-sterilized plants were used to initiate cultures. Adventitious shoot regeneration was achieved when apical and axillary buds were inoculated on gelled Murashige & Skoog (MS) medium supplemented with 6-benzylaminopurine alone (BAP) (1.0, 5.0 or 10.0 mg L-1) or combined with -naphthalene acetic acid (NAA) (1.0 or 2.0 mg L-1), after 40 days of culture. Best callus production was obtained after 30 days of petioles' culture on gelled MS medium with 2,4 dichlorophenoxyacetic acid (2,4-D) (5.0 mg L-1) combined with BAP (1.0 mg L-1). Successful shoot regeneration from callus was achieved when MS medium supplemented with zeatin (ZEA) (0.1 mg L-1) alone or combined with 2,4-D (1.0 or 5.0 mg L-1) was inoculated with friable callus obtained from petioles. All shoots were rooted by inoculation on MS medium supplemented with indole-3-acetic acid (IAA) (1.0 mg L-1). Rooted plants transferred to potting soil were successfully established. All in vitro regenerated plantlets showed to be normal, without morphological variations, being also identical to the source plant. Our study has shown that C. glaziovii can be propagated by tissue culture methods, allowing large scale multiplication of superior plants for pharmacological purposes.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física