9 resultados para Alvos de conservação
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
This research studied the effect of low density polyethylene packaging and storage temperature on the preservation of fresh-cut (minimally processed) cabbage. The cabbages, previously cooled to a temperature of 10 ºC, were selected, washed, cut in four parts (with the central stalk removed), sanitized, cut in strips, rinsed, put in the centrifuge, weighed and stored in plastic packaging of low density polyethylene (70 µm), and then stored in cold chambers at temperatures of 1 and 10 ºC for 20 days. The following aspects were evaluated: carbon dioxide, oxygen and ethylene in the internal atmosphere of the package as well as, pH, titratable acidity, total soluble solids, vitamin C, loss of fresh mass and the total soluble solids/acidity in the fresh-cut cabbage ratio. The experimental design was entirely casual, with three repetitions. The analysis parameters, except for the vitamin C, loss of fresh mass and ethylene, presented significant variation between the temperatures and days of storage. The cabbage stored at a temperature of 1 ºC presented a shelf life of around 15 days, significantly higher than that stored at 10 ºC. At this temperature, on the 8th day of storage, the product was completely decayed, unfit for commercialization or consumption.
Resumo:
Postharvest losses vary among the different vegetable products. However, among fruits and vegetables the losses generally range from 30% to 50%. Thus, this paper aimed the application of 1-methylcycloprene (1-MCP) and fast cooling with forced air (PC) on peaches, in order to estimate their effects in the ripening process of this fruit. Physiological analyses were performed, such as loss of fresh mass, firmness, pH, titratable acidity, soluble solids, ratio and CO2 production, as well as sensorial analyses such as color, texture and flavor. The experiment was divided in two phases. In the first one, concentrations of 30, 60, and 90 nL/L 1-MCP, applied at 0 ºC and 20 ºC, were tested. The fruits treated without 1-MCP were denominated control for both temperatures studied. The second phase was composed by the following treatments: cold storage (CS) or control, cooling with forced air (CFA), cooling with forced air followed by 1-MCP application (CFA + 1-MCP) and 1-MCP application (1-MCP). Among these, the CFA + 1-MCP treatment provided more firmness of the fruits in comparison to the control fruits. The respiratory rate of peaches under CFA and CFA + 1-MCP treatments decreased in comparison to the control fruit respiratory rates.
Inibidor da ação do etileno na conservação pós-colheita de Chrysanthemum morifolium Ramat cv. Dragon
Resumo:
The durability and postharvest quality of cut flowers are fundamental attributes in value along the production chain and in consumer satisfaction. The objective of this study was to evaluate the effect of chemical inhibitors of ethylene action on maintaining the postharvest quality of chrysanthemum stems (Chrysanthemum morifolium Ramat cv. Dragon). The experiment tested maintenance solutions with silver thiosulfate (STS) under five levels (distilled water, a 0.2 mM STS, the STS 0.2 mM + sucrose at 50 g L-1, STS at 0.4 mM; STS at 0.4 mM + sucrose at 50 g L-1), and date of sampling, for three levels (0, 3, 6 days). Three replications with two flower stems in each treatment were used in the experiment. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, flower color, and number of buds, open flowers and partially open flowers. Treatment with 0.2 mM STS resulted in better maintenance of fresh mass of stems. The concentration of pigments and reducing sugar was higher in those treatments in which sucrose was associated. The color and relative water content were favored in treatments STS 0.2 mM and 0.4 mM. The concentration of 0.2 mM STS obtained the best results, prolonging the vase life the stems. The quality of these stems was higher, with the best assessments of water content, color and turgidity.
Resumo:
The Orchidaceae is one of the largest flowering plants family and with a great importance to conservation. However, no survey on orchid flowers can be found in Mato Grosso do Sul. Thus, the objective of this work was to make a survey of the Orchidaceae species and of its ecology features in a riparian forest in a fragment of Floresta Estacional Semi-Decidual that belongs to the riparian forest of the Dourados River. The inventory was made by using a sweeping method for collection, and in addition to this the vertical and horizontal position of epiphytes were assessed on the hosts. For characterization of microclimate, it was used a thermohygrometer and luximeter. It was identified 17 species of 13 genera. Of the listed genera, the most abundant ones were: Acianthera, Macradenia and Capanemia. It was also noted a vertical and horizontal distribution of the Orchidaceae in relation to inverse gradient of water and light availability. Some species tended to be sensitive to height level categorization, whereas others seemed to occur with similar frequency along the host. In relation to the cardinal orientation, the apparent preferential response for south and east directions was associated to the low sampling effort and lower water availability, which could occur because the north face is opposed to the water body.
Resumo:
The post harvest cooling and/or freezing processes for horticultural products have been carried out with the objective of removing the heat from these products, allowing them a bigger period of conservation. Therefore, the knowledge of the physical properties that involve heat transference in the fig fruit Roxo de Valinhos is useful for calculating projects and systems of food engineering in general, as well as, for using in equations of thermodynamic mathematical models. The values of conductivity and thermal diffusivity of the whole fig fruit-rami index were determined, and from these values it was determined the value of the specific heat. For these determination it was used the transient method of the Line Heat Source. The results shown that the fig fruit has a thermal conductivity of 0.52 W m-1°C, thermal diffusivity of 1.56 x 10-7 m² s-1, pulp density of 815.6 kg m-3 and specific heat of 4.07 kJ kg-1 °C.
Resumo:
The cleanness level in fresh market tomatoes cleaning equipment is essential for consumer acceptance and conservation of product quality. However, the washing process in cleaning current equipments demands an excessive volume of water, leading to serious economic and environmental concerns. The objective of this work was to contribute with technical information for the washing system optimization. The conventional washing system currently used in cleaning equipment, which consists of perforated PVC pipes, was compared with a proposed system which uses commercial sprays. Characteristic curves (flow rate versus pressure) for both systems were determined in lab conditions and the respective water consumptions were compared. The results confirmed the excess of water consumption in the conventional washing systems, and the proposed system proved that is possible to reduce it, and the use of sprays allowed the rational use of the water.
Resumo:
Currently, owing to the occurrence of environmental problems, along with the need of environmental preservation, both the territory management of Hydrographic Basin and the conservation of natural resources have proven to have remarkable importance. Thus, the mean goal of the research is to raise and scrutinize social-economic and technologic data from the Mogi Guaçu River Hydrographic Basin (São Paulo, Brazil). The aim is to group municipalities with similar characteristics regarding the collected data, which may direct joint actions in the Hydrographic Basin Management. There were used both the methods of factorial analysis and automatic hierarchical classifications. Additionally, there is going to be applied a Geographical Information System to represent the outcomes of the methods aforementioned, through the evolvement of a geo-referenced database, which will allow the obtainment of information categorically distributed including theme maps of interest. The main characteristics adopted to group the municipalities were: agricultural area, sugar cane production, small farms, animal production, number of agriculture machinery and equipments and agricultural income. The methodology adopted in the Mogi Guaçu River Hydrographic Basin will be analyzed vis-à-vis its appropriateness on basin management, as well as the possibility of assisting the studies on behalf of the São Paulo Hydrographic Basin groups, to regional development.
Resumo:
One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.