Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Delays In Receiving Obstetric Care And Poor Maternal Outcomes: Results From A National Multicentre Cross-sectional Study.

The vast majority of maternal deaths in low-and middle-income countries are preventable. Delay in obtaining access to appropriate health care is a fairly common problem which can be improved. The objective of this study was to explore the association between delay in providing obstetric health care and severe maternal morbidity/death. This was a multicentre cross-sectional study, involving 27 referral obstetric facilities in all Brazilian regions between 2009 and 2010. All women admitted to the hospital with a pregnancy-related cause were screened, searching for potentially life-threatening conditions (PLTC), maternal death (MD) and maternal near-miss (MNM) cases, according to the WHO criteria. Data on delays were collected by medical chart review and interview with the medical staff. The prevalence of the three different types of delays was estimated according to the level of care and outcome of the complication. For factors associated with any delay, the PR and 95%CI controlled for cluster design were estimated. A total of 82,144 live births were screened, with 9,555 PLTC, MNM or MD cases prospectively identified. Overall, any type of delay was observed in 53.8% of cases; delay related to user factors was observed in 10.2%, 34.6% of delays were related to health service accessibility and 25.7% were related to quality of medical care. The occurrence of any delay was associated with increasing severity of maternal outcome: 52% in PLTC, 68.4% in MNM and 84.1% in MD. Although this was not a population-based study and the results could not be generalized, there was a very clear and significant association between frequency of delay and severity of outcome, suggesting that timely and proper management are related to survival.

Hypothermia And Early Neonatal Mortality In Preterm Infants.

To evaluate intervention practices associated with hypothermia at both 5 minutes after birth and at neonatal intensive care unit (NICU) admission and to determine whether hypothermia at NICU admission is associated with early neonatal death in preterm infants. This prospective cohort included 1764 inborn neonates of 22-33 weeks without malformations admitted to 9 university NICUs from August 2010 through April 2012. All centers followed neonatal International Liaison Committee on Resuscitation recommendations for the stabilization and resuscitation in the delivery room (DR). Variables associated with hypothermia (axillary temperature <36.0 °C) 5 minutes after birth and at NICU admission, as well as those associated with early death, were analyzed by logistic regression. Hypothermia 5 minutes after birth and at NICU admission was noted in 44% and 51%, respectively, with 6% of early neonatal deaths. Adjusted for confounding variables, practices associated with hypothermia at 5 minutes after birth were DR temperature <25 °C (OR 2.13, 95% CI 1.67-2.28), maternal temperature at delivery <36.0 °C (OR 1.93, 95% CI 1.49-2.51), and use of plastic bag/wrap (OR 0.53, 95% CI 0.40-0.70). The variables associated with hypothermia at NICU admission were DR temperature <25 °C (OR 1.44, 95% CI 1.10-1.88), respiratory support with cold air in the DR (OR 1.40, 95% CI 1.03-1.88) and during transport to NICU (OR 1.51, 95% CI 1.08-2.13), and cap use (OR 0.55, 95% CI 0.39-0.78). Hypothermia at NICU admission increased the chance of early neonatal death by 1.64-fold (95% CI 1.03-2.61). Simple interventions, such as maintaining DR temperature >25 °C, reducing maternal hypothermia prior to delivery, providing plastic bags/wraps and caps for the newly born infants, and using warm resuscitation gases, may decrease hypothermia at NICU admission and improve early neonatal survival.

Chronic Continuous Exenatide Infusion Does Not Cause Pancreatic Inflammation And Ductal Hyperplasia In Non-human Primates.

In this study, we aimed to evaluate the effects of exenatide (EXE) treatment on exocrine pancreas of nonhuman primates. To this end, 52 baboons (Papio hamadryas) underwent partial pancreatectomy, followed by continuous infusion of EXE or saline (SAL) for 14 weeks. Histological analysis, immunohistochemistry, Computer Assisted Stereology Toolbox morphometry, and immunofluorescence staining were performed at baseline and after treatment. The EXE treatment did not induce pancreatitis, parenchymal or periductal inflammatory cell accumulation, ductal hyperplasia, or dysplastic lesions/pancreatic intraepithelial neoplasia. At study end, Ki-67-positive (proliferating) acinar cell number did not change, compared with baseline, in either group. Ki-67-positive ductal cells increased after EXE treatment (P = 0.04). However, the change in Ki-67-positive ductal cell number did not differ significantly between the EXE and SAL groups (P = 0.13). M-30-positive (apoptotic) acinar and ductal cell number did not change after SAL or EXE treatment. No changes in ductal density and volume were observed after EXE or SAL. Interestingly, by triple-immunofluorescence staining, we detected c-kit (a marker of cell transdifferentiation) positive ductal cells co-expressing insulin in ducts only in the EXE group at study end, suggesting that EXE may promote the differentiation of ductal cells toward a β-cell phenotype. In conclusion, 14 weeks of EXE treatment did not exert any negative effect on exocrine pancreas, by inducing either pancreatic inflammation or hyperplasia/dysplasia in nonhuman primates.

Influence Of The Major Nitrite Transporter Nirc On The Virulence Of A Swollen Head Syndrome Avian Pathogenic E. Coli (apec) Strain.

Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell adhesion ability of the ΔnirC strain was about half the WT level in the presence and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.