Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Ressonância magnética e características clínicas em adultos com doenças desmielinizantes monofásicas: encefalomielite aguda disseminada ou uma variante da esclerose múltipla?

Acute disseminated encephalomyelitis (ADEM) is a widespread monophasic inflamatory disease affecting the central nervous system, that usually follows an infection or vaccination. In this study, we present an analysis of magnetic resonance imaging (MRI), cerebrospinal fluid (CSF) and clinical aspects in four patients with clinical diagnosis of ADEM. The presence of MRI demyelinating lesions was crucial, but not in itself sufficient for definitive diagnosis. Clinical and MRI follow up, in order to exclude new lesions and to reevaluate the former ones, as well as CSF, were important for the differential diagnosis with other demyelinating diseases, particularly multiple sclerosis. In addition, we have shown that early treatment with methylprednisolone after the initial symptoms was effective for improving clinical manifestations as well as for reducing MRI lesions.

Programas de educação de jovens e adultos e pesquisa acadêmica: a contribuição dos estudos do letramento

The purpose of this article is to introduce elements that allow building an interface between the academic research and the programs of basic education for youngsters and adults. It discusses contributions to these programs that can be found in the results of qualitative research studies. To this end, results of a five-year long project on teacher education are used, which aim was that of analyzing the interaction between teacher and student in youngster and adult literacy classes. The research project was conducted in natural contexts with the purpose of understanding a given social reality, and not of establishing general laws. Therefore, the credibility of its results was built through the observation of multiple contexts, and the gathering of data was made through various methods, from the perspective of several participants observed during a prolonged period of time. This empirical basis was used to evaluate recommendations contained in the report commissioned by Unesco to the International Literacy Institute for presentation at the World Forum on Education held in 2000 in Dakar. This report proposed that the continuous attendance of students to basic education programs is one of the great challenges of the new millennium. With respect to the problem of adult evasion from courses and programs, the article discusses the motivation and accessibility factors, pointed out in official documents as relevant factors to the success or failure of the programs.

Fatores associados à maior mortalidade e tempo de internação prolongado em uma unidade de terapia intensiva de adultos

OBJECTIVE: The intensive care unit is synonymous of high severity, and its mortality rates are between 5.4 and 33%. With the development of new technologies, a patient can be maintained for long time in the unit, causing high costs, psychological and moral for all involved. This study aimed to evaluate the risk factors for mortality and prolonged length of stay in an adult intensive care unit. METHODS: The study included all patients consecutively admitted to the adult medical/surgical intensive care unit of Hospital das Clínicas da Universidade Estadual de Campinas, for six months. We collected data such as sex, age, diagnosis, personal history, APACHE II score, days of invasive mechanical ventilation orotracheal reintubation, tracheostomy, days of hospitalization in the intensive care unit and discharge or death in the intensive care unit. RESULTS: Were included in the study 401 patients; 59.6% men and 40.4% women, age 53.8±18.0. The mean intensive care unit stay was 8.2±10.8 days, with a mortality rate of 13.5%. Significant data for mortality and prolonged length of stay in intensive care unit (p <0.0001), were: APACHE II>11, OT-Re and tracheostomy. CONCLUSION: The mortality and prolonged length of stay in intensive care unit intensive care unit as risk factors were: APACHE>11, orotracheal reintubation and tracheostomy.

Consenso brasileiro para a abordagem clínica e tratamento do hipotireoidismo subclínico em adultos: recomendações do Departamento de Tireoide da Sociedade Brasileira de Endocrinologia e Metabologia

INTRODUCTION: Subclinical hypothyroidism (SCH), defined as elevated concentrations of thyroid stimulating hormone (TSH) despite normal levels of thyroid hormones, is highly prevalent in Brazil, especially among women and the elderly. Although an increasing number of studies have related SCH to an increased risk of coronary artery disease and mortality, there have been no randomized clinical trials verifying the benefit of levothyroxine treatment in reducing these risks, and the treatment remains controversial. OBJECTIVE: This consensus, sponsored by the Thyroid Department of the Brazilian Society of Endocrinology and Metabolism and developed by Brazilian experts with extensive clinical experience with thyroid diseases, presents these recommendations based on evidence for the clinical management of SCH patients in Brazil. MATERIALS AND METHODS: After structuring the clinical questions, the search for evidence in the literature was initially performed in the MedLine-PubMed database and later in the Embase and SciELO - Lilacs databases. The strength of evidence was evaluated according to the Oxford classification system and established based on the experimental design used, considering the best available evidence for each question and the Brazilian experience. RESULTS: The topics covered included SCH definition and diagnosis, natural history, clinical significance, treatment and pregnancy, and the consensus issued 29 recommendations for the clinical management of adult patients with SCH. CONCLUSION: Treatment with levothyroxine was recommended for all patients with persistent SCH with serum TSH values > 10 mU/L and for certain patient subgroups.

Impacto das atividades fisicas nos indicadores de saude de sujeitos adultos : programa mexa-se

Universidade Estadual de Campinas . Faculdade de Educação Física

Creatina quinase e dor muscular tardia na musculação : estudo experimental em adultos e jovens com o "circuit weight training" e o "multiple set system"

Universidade Estadual de Campinas . Faculdade de Educação Física

A resilencia e a imagem corporal de adolescentes e adultos com mielomeningocele

Universidade Estadual de Campinas . Faculdade de Educação Física

Atividades fisicas e estados emocionais : relatos verbais sobre estados emocionais como indicadores dos efeitos de um programa de atividades fisicas para adultos

Universidade Estadual de Campinas. Faculdade de Educação Física

Aspectos de formação e transição em programas para adolescentes e adultos portadores de deficiencia mental em instituições especializadas

Universidade Estadual de Campinas. Faculdade de Educação Física

Medição da resistencia aerobica em adultos maiores atraves do teste de Mazorra Zamorra

Universidade Estadual de Campinas . Faculdade de Educação Física