15 resultados para ATROPHY SKIN DETECTION

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to evaluate long-term atrophy in contralateral hippocampal volume after surgery for unilateral MTLE, as well as the cognitive outcome for patients submitted to either selective transsylvian amygdalohippocampectomy (SelAH) or anterior temporal lobe resection (ATL). We performed a longitudinal study of 47 patients with MRI signs of unilateral hippocampal sclerosis (23 patients with right-sided hippocampal sclerosis) who underwent surgical treatment for MTLE. They underwent preoperative/postoperative high-resolution MRI as well as neuropsychological assessment for memory and estimated IQ. To investigate possible changes in the contralateral hippocampus of patients, we included 28 controls who underwent two MRIs at long-term intervals. The volumetry using preoperative MRI showed significant hippocampal atrophy ipsilateral to the side of surgery when compared with controls (p<0.0001) but no differences in contralateral hippocampal volumes. The mean postoperative follow-up was 8.7 years (± 2.5 SD; median=8.0). Our patients were classified as Engel I (80%), Engel II (18.2%), and Engel III (1.8%). We observed a small but significant reduction in the contralateral hippocampus of patients but no volume changes in controls. Most of the patients presented small declines in both estimated IQ and memory, which were more pronounced in patients with left TLE and in those with persistent seizures. Different surgical approaches did not impose differences in seizure control or in cognitive outcome. We observed small declines in cognitive scores with most of these patients, which were worse in patients with left-sided resection and in those who continued to suffer from postoperative seizures. We also demonstrated that manual volumetry can reveal a reduction in volume in the contralateral hippocampus, although this change was mild and could not be detected by visual analysis. These new findings suggest that dynamic processes continue to act after the removal of the hippocampus, and further studies with larger groups may help in understanding the underlying mechanisms.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cryosurgery is an efficient therapeutic technique used to treat benign and malignant cutaneous diseases. The primary active mechanism of cryosurgery is related to vascular effects on treated tissue. After a cryosurgical procedure, exuberant granulation tissue is formed at the injection site, probably as a result of angiogenic stimulation of the cryogen and inflammatory response, particularly in endothelial cells. To evaluate the angiogenic effects of freezing, as part of the phenomenon of healing rat skin subjected to previous injury. Two incisions were made in each of the twenty rats, which were divided randomly into two groups of ten. After 3 days, cryosurgery with liquid nitrogen was performed in one of incisions. The rats' samples were then collected, cut and stained to conduct histopathological examination, to assess the local angiogenesis in differing moments and situations. It was possible to demonstrate that cryosurgery, in spite of promoting cell death and accentuated local inflammation soon after its application, induces quicker cell proliferation in the affected tissue and maintenance of this rate in a second phase, than in tissue healing without this procedure. These findings, together with the knowledge that there is a direct relationship between mononuclear cells and neovascularization (the development of a rich system of new vessels in injury caused by cold), suggest that cryosurgery possesses angiogenic stimulus, even though complete healing takes longer to occur. The significance level for statistical tests was 5% (p<0,05).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Our objective was to investigate spinal cord (SC) atrophy in amyotrophic lateral sclerosis (ALS) patients, and to determine whether it correlates with clinical parameters. Forty-three patients with ALS (25 males) and 43 age- and gender-matched healthy controls underwent MRI on a 3T scanner. We used T1-weighted 3D images covering the whole brain and the cervical SC to estimate cervical SC area and eccentricity at C2/C3 level using validated software (SpineSeg). Disease severity was quantified with the ALSFRS-R and ALS Severity scores. SC areas of patients and controls were compared with a Mann-Whitney test. We used linear regression to investigate association between SC area and clinical parameters. Results showed that mean age of patients and disease duration were 53.1 ± 12.2 years and 34.0 ± 29.8 months, respectively. The two groups were significantly different regarding SC areas (67.8 ± 6.8 mm² vs. 59.5 ± 8.4 mm², p < 0.001). Eccentricity values were similar in both groups (p = 0.394). SC areas correlated with disease duration (r = - 0.585, p < 0.001), ALSFRS-R score (r = 0.309, p = 0.044) and ALS Severity scale (r = 0.347, p = 0.022). In conclusion, patients with ALS have SC atrophy, but no flattening. In addition, SC areas correlated with disease duration and functional status. These data suggest that quantitative MRI of the SC may be a useful biomarker in the disease.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Primary craniocervical dystonia (CCD) is generally attributed to functional abnormalities in the cortico-striato-pallido-thalamocortical loops, but cerebellar pathways have also been implicated in neuroimaging studies. Hence, our purpose was to perform a volumetric evaluation of the infratentorial structures in CCD. We compared 35 DYT1/DYT6 negative patients with CCD and 35 healthy controls. Cerebellar volume was evaluated using manual volumetry (DISPLAY software) and infratentorial volume by voxel based morphometry of gray matter (GM) segments derived from T1 weighted 3 T MRI using the SUIT tool (SPM8/Dartel). We used t-tests to compare infratentorial volumes between groups. Cerebellar volume was (1.14 ± 0.17) × 10(2) cm(3) for controls and (1.13 ± 0.14) × 10(2) cm(3) for patients; p = 0.74. VBM demonstrated GM increase in the left I-IV cerebellar lobules and GM decrease in the left lobules VI and Crus I and in the right lobules VI, Crus I and VIIIb. In a secondary analysis, VBM demonstrated GM increase also in the brainstem, mostly in the pons. While gray matter increase is observed in the anterior lobe of the cerebellum and in the brainstem, the atrophy is concentrated in the posterior lobe of the cerebellum, demonstrating a differential pattern of infratentorial involvement in CCD. This study shows subtle structural abnormalities of the cerebellum and brainstem in primary CCD.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Bologna-type sausages were produced with 50% of their pork back-fat content replaced with gels elaborated with different ratios of pork skin, water, and amorphous cellulose (1:1:0, 1:1:0.1, 1:1:0.2, 1:1:0.3, and 1:1:0.4). The impact of such replacement on the physico-chemical characteristics and the consumer sensory profiling was evaluated. The modified treatments had 42% less fat, 18% more protein, and 8% more moisture than the control group. Treatments with amorphous cellulose had a lower cooking loss and higher emulsion stability. High amorphous cellulose content (1:1:0.3 and 1:1:0.4) increased hardness, gumminess, and chewiness. The gel formulated with the ratio of 1:1:0.2 (pork skin: water: amorphous cellulose gel) provided a sensory sensation similar to that provided by fat and allowed products of good acceptance to be obtained. Therefore, a combination of pork skin and amorphous cellulose is useful in improving technological quality and producing healthier and sensory acceptable bologna-type sausages.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Solar radiation, especially ultraviolet A (UVA) and ultraviolet B (UVB), can cause damage to the human body, and exposure to the radiation may vary according to the geographical location, time of year and other factors. The effects of UVA and UVB radiation on organisms range from erythema formation, through tanning and reduced synthesis of macromolecules such as collagen and elastin, to carcinogenic DNA mutations. Some studies suggest that, in addition to the radiation emitted by the sun, artificial sources of radiation, such as commercial lamps, can also generate small amounts of UVA and UVB radiation. Depending on the source intensity and on the distance from the source, this radiation can be harmful to photosensitive individuals. In healthy subjects, the evidence on the danger of this radiation is still far from conclusive.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física