Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Antioxidative responses of cell suspension cultures of two Coffea arabica varieties to low aluminum levels at pH 5.8

The effects of aluminum (Al) on the activities of antioxidant enzymes and ferritin expression were studied in cell suspension cultures of two varieties of Coffea arabica, Mundo Novo and Icatu, in medium with pH at 5.8. The cells were incubated with 300 µM Al3+, and the Al speciation as Al3+ was 1.45% of the mole fraction. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione S-transferase (GST) were increased in Mundo Novo, whereas glutathione reductase (GR) and guaiacol peroxidase (GPOX) activities remained unchanged. SOD, GR, and GST activities were increased in Icatu, while CAT activity was not changed, and GPOX activity decreased. The expression of two ferritin genes (CaFer1 and CaFer2) were analyzed by Real-Time PCR. Al caused a downregulation of CaFER1 expression and no changes of CaFER2 expression in both varieties. The Western blot showed no alteration in ferritin protein levels in Mundo Novo and a decrease in Icatu. The differential enzymes responses indicate that the response to Al is variety-dependent.

Pyrimidine-5'-nucleotidase Campinas, A New Mutation (p.r56g) In The Nt5c3 Gene Associated With Pyrimidine-5'-nucleotidase Type I Deficiency And Influence Of Gilbert's Syndrome On Clinical Expression.

Pyrimidine-5'-nucleotidase type I (P5'NI) deficiency is an autosomal recessive condition that causes nonspherocytic hemolytic anemia, characterized by marked basophilic stippling and pyrimidine nucleotide accumulation in erythrocytes. We herein present two African descendant patients, father and daughter, with P5'N deficiency, both born from first cousins. Investigation of the promoter polymorphism of the uridine diphospho glucuronosyl transferase 1A (UGT1A) gene revealed that the father was homozygous for the allele (TA7) and the daughter heterozygous (TA6/TA7). P5'NI gene (NT5C3) gene sequencing revealed a further change in homozygosity at amino acid position 56 (p.R56G), located in a highly conserved region. Both patients developed gallstones; however the father, who had undergone surgery for the removal of stones, had extremely severe intrahepatic cholestasis and, liver biopsy revealed fibrosis and siderosis grade III, leading us to believe that the homozygosity of the UGT1A polymorphism was responsible for the more severe clinical features in the father. Moreover, our results show how the clinical expression of hemolytic anemia is influenced by epistatic factors and we describe a new mutation in the P5'N gene associated with enzyme deficiency, iron overload, and severe gallstone formation. To our knowledge, this is the first description of P5'N deficiency in South Americans.

Chemo-, Regio- And Stereoselective Heck Arylation Of Allylated Malonates: Mechanistic Insights By Esi-ms And Synthetic Application Toward 5-arylmethyl-γ-lactones.

We describe herein a general method for the controlled Heck arylation of allylated malonates. Both electron-rich and electron-poor aryldiazonium salts were readily employed as the aryl-transfer agents in good yields and in high chemo-, regio-, and stereoselectivity without formation of decarboxylated byproducts. Reaction monitoring via ESI-MS was used to support the formation of chelated Pd species through the catalytic cycle. Additionally, some Heck adducts were successfully used in the total synthesis of pharmacologically active γ-lactones.

Direct Adhesive Pin-retained Restorations For Severely Worn Dentition Treatment: A 1.5-year Follow-up Report.

Excessive occlusal surface wear can result in occlusal disharmony, functional and esthetic impairment. As a therapeutic approach, conventional single crowns have been proposed, but this kind of treatment is complex, highly invasive and expensive. This case report describes the clinical outcomes of an alternative minimally invasive treatment based on direct adhesive-pin retained restorations. A 64-year-old woman with severely worn dentition, eating problems related to missing teeth and generalized tooth hypersensitivity was referred for treatment. Proper treatment planning based on the diagnostic wax-up simulation was used to guide the reconstruction of maxillary anterior teeth with direct composite resin over self-threading dentin pins. As the mandibular remaining teeth were extremely worn, a tooth-supported overdenture was installed. A stabilization splint was also used to protect the restorations. This treatment was a less expensive alternative to full-mouth rehabilitation with positive esthetic and functional outcomes after 1.5 years of follow-up.

Synthesis And Antitumor Activity Of Novel 1-substituted Phenyl 3-(2-oxo-1,3,4-oxadiazol-5-yl) β-carbolines And Their Mannich Bases.

A series of novel 1-(substituted phenyl)-3-(2-oxo-1,3,4-oxadiazol-5-yl) β-carbolines (4a-e) and the corresponding Mannich bases 5-9(a-c) were synthesized and evaluated for their in vitro antitumor activity against seven human cancer cell lines. Compounds of 4a-e series showed a broad spectrum of antitumor activity, with GI50 values lower than 15μM for five cell lines. The derivative 4b, having the N,N-dimethylaminophenyl group at C-1, displayed the highest activity with GI50 in the range of 0.67-3.20μM. A high selectivity and potent activity were observed for some Mannich bases, particularly towards resistant ovarian (NCI-ADR/RES) cell lines (5a, 5b, 6a, 6c and 9b), and ovarian (OVCAR-03) cell lines (5b, 6a, 6c, 9a, 9b and 9c). In addition, the interaction of compound 4b with DNA was investigated by using UV and fluorescence spectroscopic analysis. These studies indicated that 4b interact with ctDNA by intercalation binding.

S-nitrosoglutathione Accelerates Recovery From 5-fluorouracil-induced Oral Mucositis.

Mucositis induced by anti-neoplastic drugs is an important, dose-limiting and costly side-effect of cancer therapy. To evaluate the effect of the topical application of S-nitrosoglutathione (GSNO), a nitric oxide donor, on 5-fluorouracil (5-FU)-induced oral mucositis in hamsters. Oral mucositis was induced in male hamsters by two intraperitoneal administrations of 5-FU on the first and second days of the experiment (60 and 40 mg/kg, respectively) followed by mechanical trauma on the fourth day. Animals received saline, HPMC or HPMC/GSNO (0.1, 0.5 or 2.0 mM) 1 h prior to the 5-FU injection and twice a day for 10 or 14 days. Samples of cheek pouches were harvested for: histopathological analysis, TNF-α and IL-1β levels, immunohistochemical staining for iNOS, TNF-α, IL-1β, Ki67 and TGF-β RII and a TUNEL assay. The presence and levels of 39 bacterial taxa were analyzed using the Checkerboard DNA-DNA hybridization method. The profiles of NO released from the HPMC/GSNO formulations were characterized using chemiluminescence. The HPMC/GSNO formulations were found to provide sustained release of NO for more than 4 h at concentration-dependent rates of 14 to 80 nmol/mL/h. Treatment with HPMC/GSNO (0.5 mM) significantly reduced mucosal damage, inflammatory alterations and cell death associated with 5-FU-induced oral mucositis on day 14 but not on day 10. HPMC/GSNO administration also reversed the inhibitory effect of 5-FU on cell proliferation on day 14. In addition, we observed that the chemotherapy significantly increased the levels and/or prevalence of several bacterial species. Topical HPMC/GSNO accelerates mucosal recovery, reduces inflammatory parameters, speeds up re-epithelization and decreases levels of periodontopathic species in mucosal ulcers.

The Ccr5Δ32 Polymorphism In Brazilian Patients With Sickle Cell Disease.

Previous studies on the role of inflammation in the pathophysiology of sickle cell disease (SCD) suggested that the CCR5Δ32 allele, which is responsible for the production of truncated C-C chemokine receptor type 5 (CCR5), could confer a selective advantage on patients with SCD because it leads to a less efficient Th1 response. We determined the frequency of the CCR5Δ32 polymorphism in 795 Afro-Brazilian SCD patients followed up at the Pernambuco Hematology and Hemotherapy Center, in Northeastern Brazil, divided into a pediatric group (3 months-17 years, n = 483) and an adult group (18-70 years, n = 312). The adult patients were also compared to a healthy control group (blood donors, 18-61 years, n = 247). The CCR5/CCR5Δ32 polymorphism was determined by allele-specific PCR. No homozygous patient for the CCR5Δ32 allele was detected. The frequency of heterozygotes in the study population (patients and controls) was 5.8%, in the total SCD patients 5.1%, in the children 5.4%, in the adults with SCD 4.8%, and in the adult controls 8.1%. These differences did not reach statistical significance. Our findings failed to demonstrate an important role of the CCR5Δ32 allele in the population sample studied here.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Effects Of Pde Type 5 Inhibitors On Left Ventricular Diastolic Dysfunction In Resistant Hypertension.

Resistant hypertension (RHTN) is a multifactorial disease characterized by blood pressure (BP) levels above goal (140/90 mmHg) in spite of the concurrent use of three or more antihypertensive drugs of different classes. Moreover, it is well known that RHTN subjects have high prevalence of left ventricular diastolic dysfunction (LVDD), which leads to increased risk of heart failure progression. This review gathers data from studies evaluating the effects of phosphodiesterase-5 (PDE-5) inhibitors (administration of acute sildenafil and short-term tadalafil) on diastolic function, biochemical and hemodynamic parameters in patients with RHTN. Acute study with sildenafil treatment found that inhibition of PDE-5 improved hemodynamic parameters and diastolic relaxation. In addition, short-term study with the use of tadalafil demonstrated improvement of LVDD, cGMP and BNP-32 levels, regardless of BP reduction. No endothelial function changes were observed in the studies. The findings of acute and short-term studies revealed potential therapeutic effects of IPDE-5 drugs on LVDD in RHTN patients.A Hipertensão arterial resistente (HAR) é uma doença multifatorial caracterizada por níveis pressóricos acima das metas (140/90 mmHg), a despeito de tratamento farmacológico otimizado de 3 ou mais fármacos anti-hipertensivos de diferentes classes. Pacientes diagnosticados como hipertensos resistentes apresentam alta prevalência de disfunção diastólica do ventrículo esquerdo (DDVE) que proporciona risco aumentado para insuficiência cardíaca. Esta revisão reúne dados de estudos prévios avaliando os efeitos dos inibidores de fosfodiesterase-5 (PDE-5) (administração aguda de sildenafil e de curto prazo de tadalafil) na função diastólica e nos parâmetros bioquímicos e hemodinâmicos em pacientes com HAR. O estudo agudo com sildenafil demonstrou que a inibição da PDE-5 melhorou os parâmetros hemodinâmicos e de relaxamento diastólico. Além disso, o estudo curto prazo com o uso de tadalafil revelou melhora da DDVE e dos níveis de GMPc e BNP-32, independente de redução de pressão arterial. A função endotelial não apresentou alteração com ambos os tratamentos. Os resultados dos estudos agudo e de curto prazo sugerem efeitos terapêuticos potenciais dos fármacos inibidores da PDE-5 na disfunção diastólica em pacientes com HAR.

Indução assimétrica 1,5-Anti na adição de enolatos de boro de metilcetonas beta-oxigenadas a aldeídos

High levels of substrate-based 1,5-stereoinduction are obtained in the boron-mediated aldol reactions of beta-oxygenated methyl ketones with achiral and chiral aldehydes. Remote induction from the boron enolates gives the 1,5-anti adducts, with the enolate pi-facial selectivity critically dependent upon the nature of the beta-alkoxy protecting group. This 1,5-anti aldol methodology has been strategically employed in the total synthesis of several natural products. At present, the origin of the high level of 1,5-anti induction obtained with the boron enolates is unclear, although a model based on a hydrogen bonding between the alkoxy oxygen and the formyl hydrogen has been recently proposed.

The syntheses of the marine metabolites 3-bromoverongiaquinol and 5-monobromocavernicolin

An efficient synthesis of the marine metabolite 3-bromoverongiaquinol (1) and the first total synthesis of 5-monobromocavernicolin (2), both isolated from the marine sponge Aplysina cavernicola, have been described based on the 1,2 addition of the lithium enolate of N,O-bistrimethylsilylacetamide (BSA, 4) to 1,4-benzoquinone (3). Bromination and purification of the crude product on silica gel chromatography provided 3-bromoverongiaquinol (1) in 50% overall yield. Under alkaline conditions, the crude product of the bromination reaction was converted to 5-monobromocavernicolin (2) in 20% yield which was also obtained in 13% yield (25% yield based on recovered starting material) from 3-bromoverongiaquinol (1).

Mapeamento de semeaduras de soja (Glycine max (L.)Merr.) mediante dados MODIS/Terra E TM/Landsat 5: um comparativo

The objective of this work was to compare the soybean crop mapping in the western of Parana State by MODIS/Terra and TM/Landsat 5 images. Firstly, it was generated a soybean crop mask using six TM images covering the crop season, which was used as a reference. The images were submitted to Parallelepiped and Maximum Likelihood digital classification algorithms, followed by visual inspection. Four MODIS images, covering the vegetative peak, were classified using the Parallelepiped method. The quality assessment of MODIS and TM classification was carried out through an Error Matrix, considering 100 sample points between soybean or not soybean, randomly allocated in each of the eight municipalities within the study area. The results showed that both the Overall Classification (OC) and the Kappa Index (KI) have produced values ranging from 0.55 to 0.80, considered good to very good performances, either in TM or MODIS images. When OC and KI, from both sensors were compared, it wasn't found no statistical difference between them. The soybean mapping, using MODIS, has produced 70% of reliance in terms of users. The main conclusion is that the mapping of soybean by MODIS is feasible, with the advantage to have better temporal resolution than Landsat, and to be available on the internet, free of charge.

Características espectrais da soja ao longo do ciclo vegetativo com imagens landsat 5/TM em área agrícola no oeste do Paraná

The objective of this study was to analyze changes in the spectral behavior of the soybean crop through spectral profiles of the vegetation indexes NDVI and GVI, expressed by different physical values such as apparent bi-directional reflectance factor (BRF), surface BRF, and normalized BRF derived from images of the Landsat 5/TM. A soybean area located in Cascavel, Paraná, was monitored by using five images of Landsat 5/TM during the 2004/2005 harvesting season. The images were submitted to radiometric transformation, atmospheric correction and normalization, determining physical values of apparent BRF, surface BRF and normalized BRF. NDVI and GVI images were generated in order to distinguish the soybean biomass spectral response. The treatments showed different results for apparent, surface and normalized BRF. Through the profiles of average NDVI and GVI, it was possible to monitor the entire soybean cycle, characterizing its development. It was also observed that the data from normalized BRF negatively affected the spectral curve of soybean crop, mainly, during the phase of vegetative growth, in the 12-9-2004 image.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.