138 resultados para Microcompression of the Trigeminal Ganglion


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell adhesion ability of the ΔnirC strain was about half the WT level in the presence and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

CONTEXT: Intestinal constipation - a common symptom among the general population - is more frequent in women. It may be secondary to an improper diet or organic or functional disturbances, such as dyskinesia of the pelvic floor. This is basically characterized by the absence of relaxation or paradoxical contraction of the pelvic floor and anal sphincter during evacuation. OBJECTIVE: To analyze, by manometric data, the anal pressure variation at rest, during evacuation effort by using the Valsalva maneuver and forced post-expiratory apnea in subjects with secondary constipation. METHODS: Twenty-one patients (19 females - 90.4%) with a mean age of 47.5 years old (23-72) were studied. The diagnosis was performed using anorectal manometry, with a catheter containing eight channels disposed at the axial axis, measuring the proximal (1) and distal (2) portions of the anal orifice. The elevation of the pressure values in relation to the resting with the evacuation effort was present in all patients. The Agachan score was used for clinical evaluation of constipation. The variables studied were: mean anal pressure of the anal orifice for 20 seconds at rest, the effort of evacuation using Valsalva maneuver and the effort of evacuation during apnea after forced expiration, as well as the area under the curve of the manometric tracing at moments Valsalva and apnea. RESULTS: The analysis of the mean values of the anal pressure variation at rest evidenced difference between proximal and distal channels (P = 0.007), independent of the moment and tendency to differ during moments Valsalva and apnea (P = 0.06). The mean of values of the area under the manometric tracing curve showed differences between moments Valsalva and apnea (P = 0.0008), either at the proximal portion or at the distal portion of the anal orifice. CONCLUSION: The effort of evacuation associated with postexpiratory apnea, when compared with the effort associated with the Valsalva maneuver, provides lower elevation of anal pressure at rest by the parameter area under the curve.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Spinocerebellar ataxia type 1 (SCA1), spinocerebellar ataxia type 2 (SCA2) and Machado-Joseph disease or spinocerebellar ataxia type 3 (MJD/SCA3) are three distinctive forms of autosomal dominant spinocerebellar ataxia (SCA) caused by expansions of an unstable CAG repeat localized in the coding region of the causative genes. Another related disease, dentatorubropallidoluysian atrophy (DRPLA) is also caused by an unstable triplet repeat and can present as SCA in late onset patients. We investigated the frequency of the SCA1, SCA2, MJD/SCA3 and DRPLA mutations in 328 Brazilian patients with SCA, belonging to 90 unrelated families with various patterns of inheritance and originating in different geographic regions of Brazil. We found mutations in 35 families (39%), 32 of them with a clear autosomal dominant inheritance. The frequency of the SCA1 mutation was 3% of all patients; and 6 % in the dominantly inherited SCAs. We identified the SCA2 mutation in 6% of all families and in 9% of the families with autosomal dominant inheritance. The MJD/SCA3 mutation was detected in 30 % of all patients; and in the 44% of the dominantly inherited cases. We found no DRPLA mutation. In addition, we observed variability in the frequency of the different mutations according to geographic origin of the patients, which is probably related to the distinct colonization of different parts of Brazil. These results suggest that SCA may be occasionally caused by the SCA1 and SCA2 mutations in the Brazilian population, and that the MJD/SCA3 mutation is the most common cause of dominantly inherited SCA in Brazil.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Oligodendrocytes and Schwann cells are engaged in myelin production, maintenance and repairing respectively in the central nervous system (CNS) and the peripheral nervous system (PNS). Whereas oligodendrocytes act only within the CNS, Schwann cells are able to invade the CNS in order to make new myelin sheaths around demyelinated axons. Both cells have some limitations in their activities, i.e. oligodendrocytes are post-mitotic cells and Schwann cells only get into the CNS in the absence of astrocytes. Ethidium bromide (EB) is a gliotoxic chemical that when injected locally within the CNS, induce demyelination. In the EB model of demyelination, glial cells are destroyed early after intoxication and Schwann cells are free to approach the naked central axons. In normal Wistar rats, regeneration of lost myelin sheaths can be achieved as early as thirteen days after intoxication; in Wistar rats immunosuppressed with cyclophosphamide the process is delayed and in rats administered cyclosporine it may be accelerated. Aiming the enlightening of those complex processes, all events concerning the myelinating cells in an experimental model are herein presented and discussed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Quimica Nova and the Journal of the Brazilian Chemical Society are two examples of successful initiatives taken by the Brazilian Chemical Society (SBQ - Sociedade Brasileira de Química), and may serve as models for the scientific societies of developing countries. Pillars of the SBQ, these two periodicals are undeniable demonstrations that idealism, utopia and dignity are the essential ingredients for transforming dreams into reality. Few believed that the Brazilian chemical community would one day have, as it does today, two scientific research periodicals indexed in the principal international data banks.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

FeBr2 has reacted with an equivalent of mnt2- (mnt = cis-1,2-dicyanoethylene-1,2-dithiolate) and the α-diimine L (L = 1,10'-phenantroline, 2,2'-bipyridine) in THF solution, and followed by adding of t-butyl-isocyanide to give [Fe(mnt)(L)(t-BuNC)2] neutral compound. The products were characterized by infrared, UV-visible and Mössbauer spectroscopy, besides thermogravimetric and conductivity data. The geometry in the equilibrium was calculated by the density functional theory and the electronic spectrum by the time-dependent. The experimental and theoretical results in good agreement have defined an octahedral geometry with two isocyanide neighbours. The π→π* intraligand electronic transition was not observed for cis-isomers in the near-IR spectral region.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

An efficient synthesis of the marine metabolite 3-bromoverongiaquinol (1) and the first total synthesis of 5-monobromocavernicolin (2), both isolated from the marine sponge Aplysina cavernicola, have been described based on the 1,2 addition of the lithium enolate of N,O-bistrimethylsilylacetamide (BSA, 4) to 1,4-benzoquinone (3). Bromination and purification of the crude product on silica gel chromatography provided 3-bromoverongiaquinol (1) in 50% overall yield. Under alkaline conditions, the crude product of the bromination reaction was converted to 5-monobromocavernicolin (2) in 20% yield which was also obtained in 13% yield (25% yield based on recovered starting material) from 3-bromoverongiaquinol (1).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The effects of ionic strength on ions in aqueous solutions are quite relevant, especially for biochemical systems, in which proteins and amino acids are involved. The teaching of this topic and more specifically, the Debye-Hückel limiting law, is central in chemistry undergraduate courses. In this work, we present a description of an experimental procedure based on the color change of aqueous solutions of bromocresol green (BCG), driven by addition of electrolyte. The contribution of charge product (z+|z-|) to the Debye-Hückel limiting law is demonstrated when the effects of NaCl and Na2SO4 on the color of BCG solutions are compared.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Understanding the flow of diaspores is fundamental for determining plant population dynamics in a particular habitat, and a lack of seeds is a limiting factor in forest regeneration, especially in isolated forest fragments. Bamboo dominance affects forest structure and dynamics by suppressing or delaying the recruitment of and colonization by tree species as well as by inhibiting the survival and growth of adult trees. The goal of the present study was to determine whether dominance of the bamboo species Aulonemia aristulata (Döll) McClure in the forest understory influences species abundance and composition. We examined the seed rain at two noncontiguous sites (1.5 km apart) within an urban forest fragment, with and without bamboo dominance (BD+ and BD- areas, respectively). Sixty seed traps (0.5 m², with a 1-mm mesh) were set in the BD+ and BD- areas, and the seed rain was sampled from January to December 2007. Diaspores were classified according to dispersal syndrome, growth form and functional type of the species to which they belonged. There were significant differences between the two areas in terms of seed density, species diversity and dispersal syndrome. The BD+ area showed greater seed density and species diversity. In both areas, seed distribution was limited primarily by impaired dispersal. Bamboo dominance and low tree density resulted in fewer propagules in the seed rain. Our results suggest that low availability of seeds in the rain does not promote the maintenance of a degraded state, characterized by the presence of bamboo.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We analyzed the structure of the understory community in the Atlantic Forest sensu lato, for which phytosociological descriptions of the understory are lacking. We delineated 50 plots of 10 × 20 m each at four sites within an Araucaria forest (a subtype of Atlantic Forest), located in the municipalities of Bananal, Campos do Jordão, Itaberá and Barra do Chapéu, all of which are in the state of São Paulo, Brazil. To sample the resident species of the understory, we randomly selected five 1 × 1 m subplots within each plot, resulting in a total sampling area of 250 m² at each site. We identified differences among the locations, mostly due to proportional differences in growth forms, in terms of species richness and the importance values within the community. Factors potentially influencing the understory structure include macroclimatic and microclimatic conditions, as well as forest fragmentation, the abundance of deciduous trees in the canopy, the surrounding vegetation and geographic location.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

cDNA arrays are a powerful tool for discovering gene expression patterns. Nylon arrays have the advantage that they can be re-used several times. A key issue in high throughput gene expression analysis is sensitivity. In the case of nylon arrays, signal detection can be affected by the plastic bags used to keep membranes humid. In this study, we evaluated the effect of five types of plastics on the radioactive transmittance, number of genes with a signal above the background, and data variability. A polyethylene plastic bag 69 μm thick had a strong shielding effect that blocked 68.7% of the radioactive signal. The shielding effect on transmittance decreased the number of detected genes and increased the data variability. Other plastics which were thinner gave better results. Although plastics made from polyvinylidene chloride, polyvinyl chloride (both 13 μm thick) and polyethylene (29 and 7 μm thick) showed different levels of transmittance, they all gave similarly good performances. Polyvinylidene chloride and polyethylene 29 mm thick were the plastics of choice because of their easy handling. For other types of plastics, it is advisable to run a simple check on their performance in order to obtain the maximum information from nylon cDNA arrays.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Type II 3β-hydroxysteroid dehydrogenase/Δ5-Δ4-isomerase (3β-HSD2), encoded by the HSD3B2 gene, is a key enzyme involved in the biosynthesis of all the classes of steroid hormones. Deleterious mutations in the HSD3B2 gene cause the classical deficiency of 3β-HSD2, which is a rare autosomal recessive disease that leads to congenital adrenal hyperplasia (CAH). CAH is the most frequent cause of ambiguous genitalia and adrenal insufficiency in newborn infants with variable degrees of salt losing. Here we report the molecular and structural analysis of the HSD3B2 gene in a 46,XY child, who was born from consanguineous parents, and presented with ambiguous genitalia and salt losing. The patient carries a homozygous nucleotide c.665C>A change in exon 4 that putatively substitutes the proline at codon 222 for glutamine. Molecular homology modeling of normal and mutant 3β-HSD2 enzymes emphasizes codon 222 as an important residue for the folding pattern of the enzyme and validates a suitable model for analysis of new mutations.