132 resultados para Emenda parlamentar, periódico, Brasil


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article deals with the theme of teacher training from the historical and theoretical perspectives. In the first part, the historical focus is introduced and the trajectory of teacher training in Brazil is examined, dividing it into six periods beginning with the passing of the Law of Schools of First Letters in 1827 and closing with the promulgation of the new law for national education in 1996. The second part deals with theoretical aspects, considering the two basic models of teacher training, their implications for the training of teachers of primary and pre-school education, the dilemma resulting from the contraposition between the two models and the way for overcoming it and concluding with observations on the training of teachers for special education.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The work aims to present an overview of social movements in actuality, in the Latin America, and presents a mapping of their main forms in Brazil. The search ponders the educational character of their actions, both for its participants, as for society in general and public agencies. The basic premise of assertion that social movements are sources of innovation and knowledge-generating arrays. However, because it is not an isolated process but social-political character, the paper search joints in the network of relationships that establish movements in political, economic and socio-cultural country, to understand the factors that generate learning built and values of political culture that are being built. . The text highlights movements that occurs in the areas of education - formal and non-formal education.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Losses of horticulture product in Brazil are significant and among the main causes are the use of inappropriate boxes and the absence of a cold chain. A project for boxes is proposed, based on computer simulations, optimization and experimental validation, trying to minimize the amount of wood associated with structural and ergonomic aspects and the effective area of the openings. Three box prototypes were designed and built using straight laths with different configurations and areas of openings (54% and 36%). The cooling efficiency of Tommy Atkins mango (Mangifera Indica L.) was evaluated by determining the cooling time for fruit packed in the wood models and packed in the commercially used cardboard boxes, submitted to cooling in a forced-air system, at a temperature of 6ºC and average relative humidity of 85.4±2.1%. The Finite Element Method was applied, for the dimensioning and structural optimization of the model with the best behavior in relation to cooling. All wooden boxes with fruit underwent vibration testing for two hours (20 Hz). There was no significant difference in average cooling time in the wooden boxes (36.08±1.44 min); however, the difference was significant in comparison to the cardboard boxes (82.63±29.64 min). In the model chosen for structural optimization (36% effective area of openings and two side laths), the reduction in total volume of material was 60% and 83% in the cross section of the columns. There was no indication of mechanical damage in the fruit after undergoing the vibration test. Computer simulations and structural study may be used as a support tool for developing projects for boxes, with geometric, ergonomic and thermal criteria.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cecropia glaziovii is a tree with used in Brazilian popular medicine. Methods allowing the clonal propagation of this species are of great interest for superior genotype multiplication and perpetuation. For this reason, we examined the effect of different culture media and different types of explants on adventitious shoot regeneration from callus and buds of C. glaziovii. Leaves, petioles and stipules obtained from aseptically grown seedlings or from pre-sterilized plants were used to initiate cultures. Adventitious shoot regeneration was achieved when apical and axillary buds were inoculated on gelled Murashige & Skoog (MS) medium supplemented with 6-benzylaminopurine alone (BAP) (1.0, 5.0 or 10.0 mg L-1) or combined with -naphthalene acetic acid (NAA) (1.0 or 2.0 mg L-1), after 40 days of culture. Best callus production was obtained after 30 days of petioles' culture on gelled MS medium with 2,4 dichlorophenoxyacetic acid (2,4-D) (5.0 mg L-1) combined with BAP (1.0 mg L-1). Successful shoot regeneration from callus was achieved when MS medium supplemented with zeatin (ZEA) (0.1 mg L-1) alone or combined with 2,4-D (1.0 or 5.0 mg L-1) was inoculated with friable callus obtained from petioles. All shoots were rooted by inoculation on MS medium supplemented with indole-3-acetic acid (IAA) (1.0 mg L-1). Rooted plants transferred to potting soil were successfully established. All in vitro regenerated plantlets showed to be normal, without morphological variations, being also identical to the source plant. Our study has shown that C. glaziovii can be propagated by tissue culture methods, allowing large scale multiplication of superior plants for pharmacological purposes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this paper was to identify, according to gender, the indexes of Mental Health and the Psychosocial Risk Factors in workers at a state University. A sample of 400 was randomly selected, 253 female and 147 male. They were assessed by means of The Questionnaire SWS Survey (Self, Work and Social) (Ostermann & Gutiérrez, 1992), validated in Brazil by Guimarães and Macfadden (1999). Univariate, bivariate, multivariate statistics were assessed. Significant associations emerged from Mental Health and Gender, and Psychosocial Risk Factors and Gender. Women showed greater Psychosocial Risk Factors, Work and Social Stress, worst mental health than men (p < 0.05), which place them at greater risk for developing physical and/or mental illness.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The extract of stevia leaves (Stevia rebaudiana Bertoni) is the only sweetener utilized in sucrose substitution which can be produced totally in Brazil. The objective of this study, was determine the temporal characteristic of sweet and bitter taste of stevia and compare with sucrose at 3 and 10% in the same equi-sweet. The time-intensity curves (T-I) for each substance were collected through the software Sistema de Coleta de Dados Tempo-Intensidade - SCDTI for Windows, where the judges recorded through of mouse the perception of each stimuli inside function of time, for each sample. The parameters of T-I curves collected were: time for intensity maxim (TImax), intensity maxim (Imax), time of decay (Td), time of plato (Platô), area under curve (Area) and total time of stimuli duration (Ttot). The parameters Td, Ttot, Area e Plato of T-I curves, for stimuli sweet in both sweetness level, were significativelly superior for stevia, while Timax e Imax were significativelly inferior (p£0,05), at differences between value for both substances were superior DESS at 10%. Sucrose didn?t present any record for simuli bitter as 3 as 10%, while stevia presented a characteristic T-I curve with intensity and total time of stimuli duration dependent of concentration.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The acceptability of nine commercial brazilian varietal white table wines (Riesling, Chardonnay and Gewürztraminer) was evaluated using sensory affective tests. The samples were assessed by 43 consumers of brazilian white wines using he nine-point structured hedonic scale. Judges were recruited based on their responses to a questionnary about consumer?s behavior towards white wines consumption. Subsequently, Analysis of Variance (ANOVA) with means comparision (Tukey test) and Internal Analysis of Preference Mapping (MDPREF) were performed on data. Analysis of Variance showed that two samples (a Riesling and a Gewürztraminer, both sweet table wines) had significantly (p < 0.05) higher acceptance means, around 7 in the hedonic scale. The least acceptance means (4,3) was obtained by a demi-sec Chardonnay wine and the other six samples achieved means around 5 in the hedonic scale, all of them either demi-sec or dry table wines. MDPREF confirmed the results showed by ANOVA showing that samples were segmented into two groups of preference. The first group was composed by 86% of consumers who prefered the sweet table wines (higher acceptance), converging to the region on the map where these samples were represented. Only 14% showed preference for the demi-sec and dry table wines, being represented on the region of the MDPREF where these samples were located. This study suggests that sweet table wines are prefered by Brazilian consumers, instead of dry or demi-sec table wines.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Easter egg is a popular chocolate-candy in egg form commercialized in Brazil during Easter time. In this research, Quantitative Descriptive Analysis was applied to select sensory attributes which best define the modifications in appearance, aroma, flavor and texture when cocoa butter equivalent (CBE) is added to Easter eggs. Samples with and without CBE were evaluated by a selected panel and fourteen attributes best describing similarities and differences between them, were defined. Terms definition, reference materials and a consensus ballot were developed. After a training period, panelists evaluated the samples in a Complete Block Design using a 9 cm unstructured scale. Principal Component Analysis, ANOVA and Tukey test (p<0.05) were applied to the data in order to select attributes which best discriminated and characterized the samples. Samples showed significant differences (p<0.05) in all attributes. Easter egg without CBE showed higher intensities (p<0.05) in relation to the following descriptors: brown color, characteristic aroma, cocoa mass aroma, cocoa butter aroma, characteristic flavor, cocoa mass flavor, hardness and brittleness.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Descriptive terminology and sensory profile of three varieties of brazilian varietal white wines (cultivars Riesling, Gewürztraminer and Chardonnay) were developed by a methodology based on the Quantitative Descriptive Analysis (QDA). The sensory panel consensually defined the sensory descriptors, their respective reference materials and the descriptive evaluation ballot. Ten individuals were selected as judges based on their discrimination, reproducibility and individual consensus with the sensory panel. Twelve descriptors were generated showing similarities and differences among the wine samples. Each descriptor was evaluated using a nine-centimeters non-structured scale with the intensity terms anchored at its ends. The collected data were analysed by ANOVA, Tukey test and Principal Component Analysis (PCA). The results showed a great difference within the sensory profile of Riesling and Gewürztraminer wines, whereas Chardonnay wines showed a lesser variation. PCA separated samples into two groups: a first group formed by wines higher in sweetness and fruitty flavor and aroma; and a second group of wines higher in sourness, adstringency, bitterness, alcoholic and fermented flavors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article aims at discussing the contributions of the Bakhtinian Circle theories to foreign language teaching and learning (HALL et al., 2005), as far as the first years of formal education in Brazil are concerned. Up to the present moment, foreign languages, including English, are not officially part of the National Curriculum of the first five schooling years. Due to the importance of English in a globalized world and despite all the controversial socio-educational impacts of such an influence, there has been an increase in the interest in this discipline at the beginning years of Brazilian public education (ROCHA, 2006), which has been happening at an irregular pace and without official parameters. Therefore, the relevance of this work lies on the possible guidelines it may offer to support a more effective, situated and meaningful teaching-learning process in that context. Standing for a pluralistic approach to language education, we take the bakhtinian speech genres as organizers of the educational process. We strongly believe that through a dialogic, pluralistic and trans/intercultural teaching (MAHER, 2007), whose main objective is the development of multi (COPE e KALANTZIS, 2000) and critical (COMBER, 2006) literacies, the hybridization of genres and cultures, as well as the creation of third spaces (KOSTOGRIZ, 2005; KUMARAVADIVELU, 2008) can happen. From this perspective, foreign language teaching and learning play a transformative role in society and English is seen as a boundary object (STAR e GRIESEMER, 1989), in and by which diversity, pluralism and polyphony can naturally find their way.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Food habits of jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) were studied between November 2000 and November 2001, in a 24.9 km² area of secondary Atlantic Rainforest and eucalypt plantation, in the Serra de Paranapiacaba, São Paulo State, Brazil. Analyses of 26 fecal and regurgitate samples, obtained over a stretch of 570.1 km, showed the consumption of 19 prey items and 74 prey occurrences. Small mammals were the most frequent food item (42.5%), followed by birds (21%), reptiles (14%) and medium-sized mammals (3%). The percent occurrence (PO) suggests that the diet consisted mainly of small rodents (30%) and birds (21%). We recorded for the first time the predation of Viperidae snakes by P. yagouaroundi. Although having a large list of items and range of dietary niche breadths (Bsta = 0.76), our data show that jaguarundi prey mainly on small vertebrates (mammals, birds or reptiles), and even in tall tropical forests or eucalypt plantations, it preys mostly on animals that come to, or live on, the ground.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A new species of dactylogyrid monogenean, Apedunculata discoidea gen. n., sp. n. is described and illustrated from the gills of the freshwater fish Prochilodus lineatus (Valenciennes, 1837) in pisciculture ponds from Pirassununga, São Paulo, Brazil. Diagnostic characters of the new genus and species are: 1) vagina dextrolateral slightly sclerotised, opening anteriorly at level of copulatory complex; 2) copulatory organ coiled with two counterclockwise rings; 3) Accessory piece distal and not articulated; 4) body disk-shaped, lacking a peduncle.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.