Comparing Near-infrared Conventional Diffuse Reflectance Spectroscopy And Hyperspectral Imaging For Determination Of The Bulk Properties Of Solid Samples By Multivariate Regression: Determination Of Mooney Viscosity And Plasticity Indices Of Natural Rubber.

Conventional reflectance spectroscopy (NIRS) and hyperspectral imaging (HI) in the near-infrared region (1000-2500 nm) are evaluated and compared, using, as the case study, the determination of relevant properties related to the quality of natural rubber. Mooney viscosity (MV) and plasticity indices (PI) (PI0 - original plasticity, PI30 - plasticity after accelerated aging, and PRI - the plasticity retention index after accelerated aging) of rubber were determined using multivariate regression models. Two hundred and eighty six samples of rubber were measured using conventional and hyperspectral near-infrared imaging reflectance instruments in the range of 1000-2500 nm. The sample set was split into regression (n = 191) and external validation (n = 95) sub-sets. Three instruments were employed for data acquisition: a line scanning hyperspectral camera and two conventional FT-NIR spectrometers. Sample heterogeneity was evaluated using hyperspectral images obtained with a resolution of 150 × 150 μm and principal component analysis. The probed sample area (5 cm(2); 24,000 pixels) to achieve representativeness was found to be equivalent to the average of 6 spectra for a 1 cm diameter probing circular window of one FT-NIR instrument. The other spectrophotometer can probe the whole sample in only one measurement. The results show that the rubber properties can be determined with very similar accuracy and precision by Partial Least Square (PLS) regression models regardless of whether HI-NIR or conventional FT-NIR produce the spectral datasets. The best Root Mean Square Errors of Prediction (RMSEPs) of external validation for MV, PI0, PI30, and PRI were 4.3, 1.8, 3.4, and 5.3%, respectively. Though the quantitative results provided by the three instruments can be considered equivalent, the hyperspectral imaging instrument presents a number of advantages, being about 6 times faster than conventional bulk spectrometers, producing robust spectral data by ensuring sample representativeness, and minimizing the effect of the presence of contaminants.

The Effects Of High Doses Of Nandrolone Decanoate And Exercise On Prostate Microvasculature Of Adult And Older Rats.

The present study aimed to investigate the effects of the interaction between the abusive use of nandrolone decanoate (ND) and physical activity on the prostate structure of adult and older rats. We evaluated whether the use of ND, associated or not with physical exercise during the post-pubertal stage, interferes with the morphophysiology of the prostate. Fifty-six male Sprague-Dawley rats were divided into eight groups. The animals were treated for eight weeks and divided into sedentary and trained groups, with or without ND use. Four groups were sacrificed 48 h after the end of the eight week experiment (adult groups), and four other groups were sacrificed at 300 days of age (older groups). The prostate was collected and processed for stereological and histopathological analysis and for the expression of AQP1 and VEGF by the Western blotting technique. Both ND and physical activity altered the ventral prostate structure of the rats; the AQP1 and VEGF expression increased in young animals subjected to physical exercise. Thus, it was concluded that the use of ND, associated or not with exercise during the post-pubertal stage, interferes with the morphophysiology of the prostate.

The C-terminal Region Of The Human P23 Chaperone Modulates Its Structure And Function.

The p23 protein is a chaperone widely involved in protein homeostasis, well known as an Hsp90 co-chaperone since it also controls the Hsp90 chaperone cycle. Human p23 includes a β-sheet domain, responsible for interacting with Hsp90; and a charged C-terminal region whose function is not clear, but seems to be natively unfolded. p23 can undergo caspase-dependent proteolytic cleavage to form p19 (p231-142), which is involved in apoptosis, while p23 has anti-apoptotic activity. To better elucidate the function of the human p23 C-terminal region, we studied comparatively the full-length human p23 and three C-terminal truncation mutants: p23₁₋₁₁₇; p23₁₋₁₃₁ and p23₁₋₁₄₂. Our data indicate that p23 and p19 have distinct characteristics, whereas the other two truncations behave similarly, with some differences to p23 and p19. We found that part of the C-terminal region can fold in an α-helix conformation and slightly contributes to p23 thermal-stability, suggesting that the C-terminal interacts with the β-sheet domain. As a whole, our results suggest that the C-terminal region of p23 is critical for its structure-function relationship. A mechanism where the human p23 C-terminal region behaves as an activation/inhibition module for different p23 activities is proposed.

Key Participants Of The Tumor Microenvironment Of The Prostate: An Approach Of The Structural Dynamic Of Cellular Elements And Extracellular Matrix Components During Epithelial-stromal Transition.

Cancer is a multistep process that begins with the transformation of normal epithelial cells and continues with tumor growth, stromal invasion and metastasis. The remodeling of the peritumoral environment is decisive for the onset of tumor invasiveness. This event is dependent on epithelial-stromal interactions, degradation of extracellular matrix components and reorganization of fibrillar components. Our research group has studied in a new proposed rodent model the participation of cellular and molecular components in the prostate microenvironment that contributes to cancer progression. Our group adopted the gerbil Meriones unguiculatus as an alternative experimental model for prostate cancer study. This model has presented significant responses to hormonal treatments and to development of spontaneous and induced neoplasias. The data obtained indicate reorganization of type I collagen fibers and reticular fibers, synthesis of new components such as tenascin and proteoglycans, degradation of basement membrane components and elastic fibers and increased expression of metalloproteinases. Fibroblasts that border the region, apparently participate in the stromal reaction. The roles of each of these events, as well as some signaling molecules, participants of neoplastic progression and factors that promote genetic reprogramming during epithelial-stromal transition are also discussed.

The Influence Of The Buffering Capacity On The Production Of Organic Acids And Alcohols From Wastewater In Anaerobic Reactor.

Some bacteria common in anaerobic digestion process can ferment a broad variety of organic compounds to organic acids, alcohols, and hydrogen, which can be used as biofuels. Researches are necessary to control the microbial interactions in favor of the alcohol production, as intermediary products of the anaerobic digestion of organic compounds. This paper reports on the effect of buffering capacity on the production of organic acids and alcohols from wastewater by a natural mixed bacterial culture. The hypothesis tested was that the increase of the buffering capacity by supplementation of sodium bicarbonate in the influent results in benefits for alcohol production by anaerobic fermentation of wastewater. When the influent was not supplemented with sodium bicarbonate, the chemical oxygen demand (COD)-ethanol and COD-methanol detected in the effluent corresponded to 22.5 and 12.7 % of the COD-sucrose consumed. Otherwise, when the reactor was fed with influent containing 0.5 g/L of sodium bicarbonate, the COD-ethanol and COD-methanol were effluents that corresponded to 39.2 and 29.6 % of the COD-sucrose consumed. Therefore, the alcohol production by supplementation of the influent with sodium bicarbonate was 33.6 % higher than the fermentation of the influent without sodium bicarbonate.

Frequency of the different mutations causing spinocerebellar ataxia (SCA1, SCA2, MJD/SCA3 and DRPLA) in a large group of Brazilian patients

Spinocerebellar ataxia type 1 (SCA1), spinocerebellar ataxia type 2 (SCA2) and Machado-Joseph disease or spinocerebellar ataxia type 3 (MJD/SCA3) are three distinctive forms of autosomal dominant spinocerebellar ataxia (SCA) caused by expansions of an unstable CAG repeat localized in the coding region of the causative genes. Another related disease, dentatorubropallidoluysian atrophy (DRPLA) is also caused by an unstable triplet repeat and can present as SCA in late onset patients. We investigated the frequency of the SCA1, SCA2, MJD/SCA3 and DRPLA mutations in 328 Brazilian patients with SCA, belonging to 90 unrelated families with various patterns of inheritance and originating in different geographic regions of Brazil. We found mutations in 35 families (39%), 32 of them with a clear autosomal dominant inheritance. The frequency of the SCA1 mutation was 3% of all patients; and 6 % in the dominantly inherited SCAs. We identified the SCA2 mutation in 6% of all families and in 9% of the families with autosomal dominant inheritance. The MJD/SCA3 mutation was detected in 30 % of all patients; and in the 44% of the dominantly inherited cases. We found no DRPLA mutation. In addition, we observed variability in the frequency of the different mutations according to geographic origin of the patients, which is probably related to the distinct colonization of different parts of Brazil. These results suggest that SCA may be occasionally caused by the SCA1 and SCA2 mutations in the Brazilian population, and that the MJD/SCA3 mutation is the most common cause of dominantly inherited SCA in Brazil.

Behaviour of oligodendrocytes and Schwann cells in an experimental model of toxic demyelination of the central nervous system

Oligodendrocytes and Schwann cells are engaged in myelin production, maintenance and repairing respectively in the central nervous system (CNS) and the peripheral nervous system (PNS). Whereas oligodendrocytes act only within the CNS, Schwann cells are able to invade the CNS in order to make new myelin sheaths around demyelinated axons. Both cells have some limitations in their activities, i.e. oligodendrocytes are post-mitotic cells and Schwann cells only get into the CNS in the absence of astrocytes. Ethidium bromide (EB) is a gliotoxic chemical that when injected locally within the CNS, induce demyelination. In the EB model of demyelination, glial cells are destroyed early after intoxication and Schwann cells are free to approach the naked central axons. In normal Wistar rats, regeneration of lost myelin sheaths can be achieved as early as thirteen days after intoxication; in Wistar rats immunosuppressed with cyclophosphamide the process is delayed and in rats administered cyclosporine it may be accelerated. Aiming the enlightening of those complex processes, all events concerning the myelinating cells in an experimental model are herein presented and discussed.

Synthesis, characterization, DFT and Td-dfT study of the [Fe(mnt)(L)(t-BuNC) 2] octahedral complex (L = phen, bipy)

FeBr2 has reacted with an equivalent of mnt2- (mnt = cis-1,2-dicyanoethylene-1,2-dithiolate) and the α-diimine L (L = 1,10'-phenantroline, 2,2'-bipyridine) in THF solution, and followed by adding of t-butyl-isocyanide to give [Fe(mnt)(L)(t-BuNC)2] neutral compound. The products were characterized by infrared, UV-visible and Mössbauer spectroscopy, besides thermogravimetric and conductivity data. The geometry in the equilibrium was calculated by the density functional theory and the electronic spectrum by the time-dependent. The experimental and theoretical results in good agreement have defined an octahedral geometry with two isocyanide neighbours. The π→π* intraligand electronic transition was not observed for cis-isomers in the near-IR spectral region.

The syntheses of the marine metabolites 3-bromoverongiaquinol and 5-monobromocavernicolin

An efficient synthesis of the marine metabolite 3-bromoverongiaquinol (1) and the first total synthesis of 5-monobromocavernicolin (2), both isolated from the marine sponge Aplysina cavernicola, have been described based on the 1,2 addition of the lithium enolate of N,O-bistrimethylsilylacetamide (BSA, 4) to 1,4-benzoquinone (3). Bromination and purification of the crude product on silica gel chromatography provided 3-bromoverongiaquinol (1) in 50% overall yield. Under alkaline conditions, the crude product of the bromination reaction was converted to 5-monobromocavernicolin (2) in 20% yield which was also obtained in 13% yield (25% yield based on recovered starting material) from 3-bromoverongiaquinol (1).

Seed rain in areas with and without bamboo dominance within an urban fragment of the Atlantic Forest

Understanding the flow of diaspores is fundamental for determining plant population dynamics in a particular habitat, and a lack of seeds is a limiting factor in forest regeneration, especially in isolated forest fragments. Bamboo dominance affects forest structure and dynamics by suppressing or delaying the recruitment of and colonization by tree species as well as by inhibiting the survival and growth of adult trees. The goal of the present study was to determine whether dominance of the bamboo species Aulonemia aristulata (D��ll) McClure in the forest understory influences species abundance and composition. We examined the seed rain at two noncontiguous sites (1.5 km apart) within an urban forest fragment, with and without bamboo dominance (BD+ and BD- areas, respectively). Sixty seed traps (0.5 m², with a 1-mm mesh) were set in the BD+ and BD- areas, and the seed rain was sampled from January to December 2007. Diaspores were classified according to dispersal syndrome, growth form and functional type of the species to which they belonged. There were significant differences between the two areas in terms of seed density, species diversity and dispersal syndrome. The BD+ area showed greater seed density and species diversity. In both areas, seed distribution was limited primarily by impaired dispersal. Bamboo dominance and low tree density resulted in fewer propagules in the seed rain. Our results suggest that low availability of seeds in the rain does not promote the maintenance of a degraded state, characterized by the presence of bamboo.

Evaluation of the cytotoxic and genotoxic potential of water from the River Paraíba do Sul, in Brazil, with the Allium cepa L. test

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of the new guidelines and consensuses for the management of hypothyroidism, thyroid nodules, and differentiated thyroid cancer

233

Democracia Corinthiana : sentidos e significados da participação dos jogadores = Corinthians democracy : meanings and significance of the players' participation

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise do desempenho muscular do quadríceps e dos isquiotibiais em função da série temporal e da amplitude de movimento de atletas amadoras de futsal feminino = : Analysis of muscle performance of the quadriceps and hamstrings as a function of the times series and range of motion of amateurfemale futsal athletes

Universidade Estadual de Campinas . Faculdade de Educação Física