174 resultados para Automatically identify


Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper aims to identify and analyze the reasons pointed by mothers to prolong breastfeeding beyond the first year of the child s life. The study involved 40 mothers whose children were treated in the Preventive Program of Research and Dental Treatment Center for Special Patients - Dental School of Piracicaba - UNICAMP. The group consisted of mothers who prolonged the breastfeeding beyond the baby s first year of life. All mothers were surveyed by a researcher using a specific questionnaire. In order to avoid information loss, the interviews were taped, then transcripted. Results showed that the main cause of the extended breastfeeding was maternal pleasure. It was also observed that the mother and infant attachment favors prolonged breastfeeding occurrence. Further studies should be carried out for more accurate functional analyses of variable that lead to extend breastfeeding or to wean.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

How should one consider the responsibility of the translator, who is located between the differences of two linguistic systems and in the middle of the various idioms constitute each of the languages involved in the translation? (P. Ottoni). What is the role of the translator in inter-acting with both his/her mother tongue and the idiom of the other? These two questions will be discussed in order to reflect on the responsibility of translating the un-translatable. Two hypotheses orient the paper: 1 - an idiom spoken idiomatically is known as the mother tongue and is not appropriated, so that accommodating the other in one's own language automatically considers his/her idiom (J. Derrida) and 2 - face-to-face with language and its idioms, the translator is trapped in a double (responsibility) bind; faced with something which cannot be translated, he/she is forced to perceive it in another way. In conclusion, how should one consider the responsibility of translating the un-translatable Jacques Derrida?

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This article has the aim to expand the perspective of research in the field of morality. We present a proposal of morality study of outlaw teenagers according to Thinking Organizer Models Theory. Through the idea of complexity we search to understand the cognitive process in the elaboration of moral reasoning inside situations of conflict. With this perspective, we developed a research that aimed to identify which organizer models were applied by 20 outlaw male teenagers who abide by social punishment to solve the hypothetical moral conflicts. Through interviews we told them a situation of moral conflict that involved friendship relation, physical aggression and steal. We could identified several models which were joined in three categories. Such models reflected the diversity and regularity that are present inside the elaborated reasoning to solve the conflicts shown by us. We conclude that the diversity of organizer models identified shows the importance of the contents in the construction of moral reasoning.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of this paper was to identify, according to gender, the indexes of Mental Health and the Psychosocial Risk Factors in workers at a state University. A sample of 400 was randomly selected, 253 female and 147 male. They were assessed by means of The Questionnaire SWS Survey (Self, Work and Social) (Ostermann & Gutiérrez, 1992), validated in Brazil by Guimarães and Macfadden (1999). Univariate, bivariate, multivariate statistics were assessed. Significant associations emerged from Mental Health and Gender, and Psychosocial Risk Factors and Gender. Women showed greater Psychosocial Risk Factors, Work and Social Stress, worst mental health than men (p < 0.05), which place them at greater risk for developing physical and/or mental illness.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Thyroid nodules are frequent findings, especially when sensitive imaging methods are used. Although thyroid cancer is relatively rare, its incidence is increasing, particularly in terms of small tumors, which have an uncertain clinical relevance. Most patients with differentiated thyroid cancer exhibit satisfactory clinical outcomes when treatment is appropriate, and their mortality rate is similar to that of the overall population. However, relapse occurs in a considerable fraction of these patients, and some patients stop responding to conventional treatment and eventually die from their disease. Therefore, the challenge is how to identify the individuals who require more aggressive disease management while sparing the majority of patients from unnecessary treatments and procedures. We have updated the Brazilian Consensus that was published in 2007, emphasizing the diagnostic and therapeutic advances that the participants, representing several Brazilian university centers, consider most relevant in clinical practice. The formulation of the present guidelines was based on the participants' experience and a review of the relevant literature.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Purpose: Amblyopia is the most common form of visual problem in children and for more than 250 years occlusion therapy is the standard treatment. Thus our purpose is to identify the factors that influence the outcome of amblyopia treatment with occlusion therapy. Methods: We reviewed 169 amblyopic children seen in the outpatient clinic of amblyopia of the Campinas State University, between January 1996 and May 1998. Patients were analyzed regar-ding sex, age at start of treatment (3 groups), affected eye, type of amblyopia (strabismic, anisometropic, visual depri-vation, associated), follow-up, initial visual acuity (light, moderate, severe), compliance with treatment (good, poor) and outcome (fully treated, partially treated, not treated). Results: Compliance was not seen to be significantly related to age at start of treatment (p=0.68) or initial visual acuity (p=0.82). 52.67% of the patients were fully treated while 19.52% were partially treated and 27.81% were not treated. Children recorded as showing good compliance had a significantly better outcome than those with poor complian-ce (p=0.0009). Neither the age at start of treatment (p=0.39) nor the initial visual acuity (p=0.30) were significantly corre-lated with the final outcome. Conclusions: We concluded that the main factor affecting the final outcome of amblyopia treatment is compliance.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Purpose: To identify improvement in visual performance of low vision students after assessment and management conducted at the Low Vision Service of State University of Campinas (UNICAMP). Method: Fourteen low vision students aged six to 30 years, attended in a room with resources for visual deficiency in Americana and Santa Bárbara d'Oeste -- SP during 1998 received complete ophthalmologic examination, specialized low vision assessment and educational intervention. Results: The most prevalent cause of vision loss was operated congenital cataract with four cases (28.6%), followed by congenital bilateral toxoplasmic macular scars and eye malformation, both with two cases (14.3%) cases each. Eight students (57.2%) had acuity classified as severe vision loss, four (28.6%) profound, one (7.1%) moderate and one (7.1%) nearly normal vision. Twelve (85.7%) were behind expected school grade. Optical aids were prescribed for 12 (85.8%) students but only 7 (58.3%) acquired the aids thus improving significantly their school performance. Conclusion: All students improved school performance even considering that 12 (85.7%) had severe to profound vision loss. As a group their performance could even be better if the optical aid prescriptions were acquired by all. This indicates the need of a social work to support such needs. For good results at school and effective student inclusion a partnership between school, family and specialized education is necessary. We recommend to promote the benefits of the resource room.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

PURPOSE: To evaluate the need for artificial tears by glaucoma patients under topical hypotensive treatment and to identify risk factors associated with it. METHODS: The charts of 175 glaucoma patients under medical treatment and 175 age-matched controls were reviewed. Age, gender, use of artificial tears, number of glaucoma medications used, and duration of treatment were recorded. RESULTS: Significantly more glaucoma patients (n=92; 52.6%) used artificial tears compared to age-matched controls (n=31; 17.7%) (p<0.001). Significantly more females (n=81; 39%) than males (n=42; 28.9%) used artificial tears (p=0.036). When the whole population was analyzed, female gender (OR=1.63) and the presence of glaucoma (OR= 5.14) were risk factors for the use of artificial tears (p<0.05). When the glaucoma population was analyzed, female gender (OR=2.57), number of medications >2 (OR=1.92), and duration of treatment >5 years (OR=2.93) were risk factors for the use of artificial tears (p<0.05). CONCLUSIONS: Topical treatment with antiglaucoma medication is a risk factor for the use of artificial tears. Female gender and long-term treatment of glaucoma with two or more medications were aggravating factors for the need for artificial tears.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física