83 resultados para script development


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article presents a characterization of the lexical competence (vocabulary knowledge and use) of students learning to read in EFL in a public university in São Paulo state. Although vocabulary has been consistently cited as one of the EFL reader´s main source of difficulty, there is no data in the literature which shows the extent of the difficulties. The data for this study is part of a previous research, which investigates, from the perspective of an interactive model of reading, the relationship between lexical competence and EFL reading comprehension. Quantitative as well as qualitative data was considered. For this study, the quantitative data is the product of vocabulary tests of 49 subjects while the qualitative data comprises pause protocols of three subjects, with levels of reading ability ranging from good to poor, selected upon their performance in the quantitative study. A rich concept of vocabulary knowledge was adapted and used for the development of vocabulary tests and analysis of protocols. The results on both studies show, with a few exceptions, the lexical competence of the group to be vague and imprecise in two dimensions: quantitative (number of known words or vocabulary size) and qualitative (depth or width of this knowledge). Implications for the teaching of reading in a foreign context are discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper tries to show that the developments in linguistic sciences are better viewed as stages in a single research program, rather than different ideological -isms. The first part contains an overview of the structuralistas' beliefs about the universality and equivalence of human languages, and their search for syntactic universals. In the second part, we will see that the generative program, in its turn, tries to answer why language is a universal faculty in the human species and addresses questions about its form, its development and its use. In the second part, we will see that the paper gives a brief glimpse of the tentative answers the program has been giving to each of these issues.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This retrospective paper will shed light on the relations between Linguistics and Archaeology by drawing special attention to the history of Archaeology and the influence of Linguistic models for the development of archaeological interpretive frameworks. Reference will be made to culture history theoreticians, like Gordon Childe, to processual archaeologists influenced by Structuralism and to post-processual discourse analysis. The paper will conclude stressing the importance of Linguistics to archaeological thought.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article presents a panorama of the area of the linguistics of the indigenous languages in Brazil within the discipline of Brazilian linguiistics as a whole. Special attention is given to those aspects related to its specific development. It is argued that in contrast to what is commonly supposed, the arrival of the Summer Institute of Linguistics (1959) not only was not the beginning of this area of study in the country, but it even contributed to the delay in its establishment. It was only after the return of Brazilian scholars educated abroad who were interested in the study of the national indigenous languages that a specialized branch of linguistics directed to the study of these languages began to take form. The present situation of the area and perspectives for future development are both explored.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper aims to discuss the future -- and the proper survival of Textlinguistics this millenium, and the challenges it has to face in order to contribute to the development of Human Sciences in a new era.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The development and use of techniques that extend the life vase of the flowers, maintaining the quality of the product, is essential for reducing postharvest losses. The objective of this work was to evaluate different solutions for maintenance, associated or not to sucrose, in maintaining the postharvest quality of chrysanthemum stems. The treatments used distilled water, 8-HQC to 100 mg L-1, 8-HQC to 100 mg L-1 + sucrose 50 g L-1, 8-HQC to 200 mg L-1, 8-HQC to 200 mg L-1 + sucrose 50 g L-1. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, color of the flowers, and number of buttons, open flowers and partially open flowers. The combination of 8-HQC 200 mg L-1 + sucrose 50 g L-1 was the best performance that made for maintaining the quality of flower stems, favoring the opening of buttons and turgidity of petals. Sucrose contributed to better maintenance of the reserve substances in the shaft, which had increased the flower vase life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article intends to discuss the relationship between morality, democracy and education within the perspective of the complex thinking, pointing to paths and proposals for its effective implementation in the educational routine, under the conviction that this is an imperative of the new social demands presented to the contemporary schooling. Understanding that one of the purposes of education is the ethical development, the author proposes intentional actions such that through them the school practices can offer to the subjects of education the necessary tools to build their cognitive, affective, cultural, and organic competence, thereby enabling them to act morally in the world. To that effect, seven aspects of school reality that hamper or contribute to school democratization are identified and discussed, which must be understood from the paradigm of complexity: school contents, classroom methodology, the nature of interpersonal relationships, the values, self-esteem and self-knowledge of the school community, as well as the school management processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of this article is to introduce elements that allow building an interface between the academic research and the programs of basic education for youngsters and adults. It discusses contributions to these programs that can be found in the results of qualitative research studies. To this end, results of a five-year long project on teacher education are used, which aim was that of analyzing the interaction between teacher and student in youngster and adult literacy classes. The research project was conducted in natural contexts with the purpose of understanding a given social reality, and not of establishing general laws. Therefore, the credibility of its results was built through the observation of multiple contexts, and the gathering of data was made through various methods, from the perspective of several participants observed during a prolonged period of time. This empirical basis was used to evaluate recommendations contained in the report commissioned by Unesco to the International Literacy Institute for presentation at the World Forum on Education held in 2000 in Dakar. This report proposed that the continuous attendance of students to basic education programs is one of the great challenges of the new millennium. With respect to the problem of adult evasion from courses and programs, the article discusses the motivation and accessibility factors, pointed out in official documents as relevant factors to the success or failure of the programs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article aims at discussing the contributions of the Bakhtinian Circle theories to foreign language teaching and learning (HALL et al., 2005), as far as the first years of formal education in Brazil are concerned. Up to the present moment, foreign languages, including English, are not officially part of the National Curriculum of the first five schooling years. Due to the importance of English in a globalized world and despite all the controversial socio-educational impacts of such an influence, there has been an increase in the interest in this discipline at the beginning years of Brazilian public education (ROCHA, 2006), which has been happening at an irregular pace and without official parameters. Therefore, the relevance of this work lies on the possible guidelines it may offer to support a more effective, situated and meaningful teaching-learning process in that context. Standing for a pluralistic approach to language education, we take the bakhtinian speech genres as organizers of the educational process. We strongly believe that through a dialogic, pluralistic and trans/intercultural teaching (MAHER, 2007), whose main objective is the development of multi (COPE e KALANTZIS, 2000) and critical (COMBER, 2006) literacies, the hybridization of genres and cultures, as well as the creation of third spaces (KOSTOGRIZ, 2005; KUMARAVADIVELU, 2008) can happen. From this perspective, foreign language teaching and learning play a transformative role in society and English is seen as a boundary object (STAR e GRIESEMER, 1989), in and by which diversity, pluralism and polyphony can naturally find their way.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article reports the results from the research work which objects the critical and profound study about the ADHD (Attention Deficit/Hyperactivity Disorder) in the courses for teachers' development in College Education, under its various dimensions - social, cultural, pedagogical, biological. The investigation focused on five adults with diagnosis for ADHD. The methodology used was the Case Study, developed from the Oral History as a source of data. The results that were obtained suggest that the study, proposed in the research, may contribute significantly for the teachers to know determining factors of the school performance of students with this disorder, as well as to guide them in the search of partnership with other professionals - doctors and psychologists, for example - when such partnership becomes necessary.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: The intensive care unit is synonymous of high severity, and its mortality rates are between 5.4 and 33%. With the development of new technologies, a patient can be maintained for long time in the unit, causing high costs, psychological and moral for all involved. This study aimed to evaluate the risk factors for mortality and prolonged length of stay in an adult intensive care unit. METHODS: The study included all patients consecutively admitted to the adult medical/surgical intensive care unit of Hospital das Clínicas da Universidade Estadual de Campinas, for six months. We collected data such as sex, age, diagnosis, personal history, APACHE II score, days of invasive mechanical ventilation orotracheal reintubation, tracheostomy, days of hospitalization in the intensive care unit and discharge or death in the intensive care unit. RESULTS: Were included in the study 401 patients; 59.6% men and 40.4% women, age 53.8±18.0. The mean intensive care unit stay was 8.2±10.8 days, with a mortality rate of 13.5%. Significant data for mortality and prolonged length of stay in intensive care unit (p <0.0001), were: APACHE II>11, OT-Re and tracheostomy. CONCLUSION: The mortality and prolonged length of stay in intensive care unit intensive care unit as risk factors were: APACHE>11, orotracheal reintubation and tracheostomy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Increasing water scarcity and depleted water productivity in irrigated soils are inducing farmers to adopt improved varieties, such as those with high-capacity tolerance. The use of tolerant varieties of sugarcane might substantially avoid the decline of productivity under water deficit. This research aimed to evaluate the harmful effects of drought on the physiology of two sugarcane varieties (RB867515 and RB962962) during the initial development. Young plants were subjected to irrigation suspension until total stomata closure, and then rewatered. Significant reduction on stomatal conductance, transpiration, and net photosynthesis were observed. RB867515 showed a faster stomatal closure while RB962962 slowed the effects of drought on the gas exchanges parameters with a faster recovering after rewatering. Accumulation of carbohydrates, amino acids, proline, and protein in the leaves and roots of the stressed plants occurred in both varieties, substantially linked to reduction of the leaf water potential. Due to the severity of stress, this accumulation was not enough to maintain the cell turgor pressure, so relative water content was diminished. Water stress affected the contents of chlorophyll (a, b, and total) in both varieties, but not the levels of carotenoids. There was a significant reduction in dry matter under stress. In conclusion, RB962962 variety endured stressed conditions more than RB867515, since it slowed down the damaging effects of drought on the gas exchanges. In addition, RB962962 presented a faster recovery than RB867515, a feature that qualifies it as a variety capable of enduring short periods of drought without major losses in the initial stage of its development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The unusual development of branches along the stem of Euterpe edulis is described for the first time. Branches originated at 2 to 190 cm from the ground. Ramified individuals and branches were able to produce reproductive structures and some branches produced roots. A plausible cause for the observed anomaly could be genetic problems due to small population sizes. The better agreement of this process can have a positive effect in the harvest of the heart of palm through the artificial induction of sprouts, what would prevent the death of the individual.