103 resultados para Contemporary Brazilian historical novel


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article analyses the emergence and development of social policies for children and adolescents attendance that are in line with the development process of the Brazilian social protection system, focusing on some of the main representations attributed to childhood, according to the historical and political periods. It seeks to present the notion of childhood instituted under the constitution of the Brazilian welfare state, in such a way as to place it within the broader context of the historical and political transformations that involved the emergence and consolidation of the social policies directed towards children and adolescents in Brazil in the 20th century and the beginning of the 21st.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article takes the concepts of biopower and governmentality as the starting point for an analysis of certain recent Brazilian government documents about the introduction of Philosophy as a subject in secondary school. In the 1980s, this argument centered on Philosophy's so-called criticism and its potential for preparing citizens for a democratic society, was used by the movements aimed to restore democracy in Brazil. This argument appears to have been assimilated by the Brazilian government, because it is stated in the Guidelines and Bases of Education Law, secondary school students should demonstrate knowledge of philosophy necessary for the exercise of citizenship. The argument also appears in documents such as the PCN and PCN+ (National Curricular Parameters) and OCEM (Curriculum Guidelines for Secondary School) in their chapters on Philosophy. These documents are examined here in the light of governmentality, making explicit how Philosophy is equipped to train young people according to what is understood as a modern democratic society.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Quimica Nova and the Journal of the Brazilian Chemical Society are two examples of successful initiatives taken by the Brazilian Chemical Society (SBQ - Sociedade Brasileira de Química), and may serve as models for the scientific societies of developing countries. Pillars of the SBQ, these two periodicals are undeniable demonstrations that idealism, utopia and dignity are the essential ingredients for transforming dreams into reality. Few believed that the Brazilian chemical community would one day have, as it does today, two scientific research periodicals indexed in the principal international data banks.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In the context of quality and good laboratory practices, the article recovers some historical data. From a specific Institutional situation (CPQBA/UNICAMP), is presented an experience of establishing and implementing a standard (NIT-DICLA-035) for good laboratory practice according to definitions of the Brazilian authority (INMETRO) responsible for regulating, monitoring, supervising and recognition in this area. The issue aims to focus on studies of pesticide residues in GLP parameters.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mental health problems are common in primary health care, particularly anxiety and depression. This study aims to estimate the prevalence of common mental disorders and their associations with socio-demographic characteristics in primary care in Brazil (Family Health Strategy). It involved a multicenter cross-sectional study with patients from Rio de Janeiro, São Paulo, Fortaleza (Ceará State) and Porto Alegre (Rio Grande do Sul State), assessed using the General Health Questionnaire (GHQ-12) and the Hospital Anxiety and Depression Scale (HAD). The rate of mental disorders in patients from Rio de Janeiro, São Paulo, Fortaleza and Porto Alegre were found to be, respectively, 51.9%, 53.3%, 64.3% and 57.7% with significant differences between Porto Alegre and Fortaleza compared to Rio de Janeiro after adjusting for confounders. Prevalence proportions of mental problems were especially common for females, the unemployed, those with less education and those with lower incomes. In the context of the Brazilian government's moves towards developing primary health care and reorganizing mental health policies it is relevant to consider common mental disorders as a priority alongside other chronic health conditions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper reintroduces the discussion about stress-timing in Brazilian Portuguese (BP). It begins by surveying some phonetic and phonological issues raised by the syllable- vs stress-timed dichotomy which culminated with the emergence of the p-center notion. Strict considerations of timing of V-V units and stress groups are taken into account to analyze the long term coupling of two basic oscillators (vowel and stress flow). This coupling allows a two-parameter characterization of language rhythms (coupling strength and speech rate) revealing that BP utterances present a high-degree of syllable-timing. A comparison with other languages, including European Portuguese, is also presented. The results analyzed indicate that Major's arguments for considering Portuguese (sic) as stress-timing are misleading.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article deals with the theme of teacher training from the historical and theoretical perspectives. In the first part, the historical focus is introduced and the trajectory of teacher training in Brazil is examined, dividing it into six periods beginning with the passing of the Law of Schools of First Letters in 1827 and closing with the promulgation of the new law for national education in 1996. The second part deals with theoretical aspects, considering the two basic models of teacher training, their implications for the training of teachers of primary and pre-school education, the dilemma resulting from the contraposition between the two models and the way for overcoming it and concluding with observations on the training of teachers for special education.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This text which discusses the central theme of the National Conference on Education (CONAE), held in Brasília from 28th March to 1st April 2010, deals with the concept of a National System of Education in articulation with the National Plan of Education. To that end, after pointing to the basic uses of the concept of system, it discusses the question of the National System of Education exploring the federative question in order to reveal the complete compatibility of the organization of the National System of Education with the federative regime. Thereafter, it deals with the historical meaning of the National Plan of Education demonstrating that the plan is a demand of the system, since planned action is implicit in systematized education. Thus the National Plan of Education is fulfilling those goals and objectives for which it is responsible.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Y-chromosome-located SRY gene encodes a small testis-specific protein containing a DNA-binding motif known as the HMG (high mobility group) box. However, mutations in SRY are not frequent especially in cases of 46,XY partial gonadal dysgenesis. Several sex-determining genes direct the fate of the bipotential gonad to either testis or ovary. In addition, heterozygous small deletions in 9p can cause complete and partial XY gonadal dysgenesis without other symptoms. Human DMRT1 gene, which is located at 9p24.3, is expressed in testis and ovary and has been considered, among others, a candidate autosomal gene responsible for gonadal dysgenesis. In this report we describe a nucleotide insertion in DMRT1 3'UTR in a patient of XY partial gonadal dygenesis. The 3'UTR+11insT is located within a conserved motif important for mRNA stabilization.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Deficiency of the enzyme P450 oxidoreductase is a rare form of congenital adrenal hyperplasia with characteristics of combined and partial impairments in steroidogenic enzyme activities, as P450 oxidoreductase transfers electrons to CYP21A2, CYP17A1, and CYP19A1. It results in disorders of sex development and skeletal malformations similar to Antley-Bixley syndrome. We report the case of a 9-year-old girl who was born with virilized genitalia (Prader stage V), absence of palpable gonads, 46,XX karyotype, and hypergonadotropic hypogonadism. During the first year of life, ovarian cyst, partial adrenal insufficiency, and osteoarticular changes, such as mild craniosynostosis, carpal and tarsal synostosis, and limited forearm pronosupination were observed. Her mother presented severe virilization during pregnancy. The molecular analysis of P450 oxidoreductase gene revealed compound heterozygosis for the nonsense p.Arg223*, and the novel missense p.Met408Lys, inherited from the father and the mother, respectively. Arq Bras Endocrinol Metab. 2012;56(8):578-85

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Thyroid nodules are frequent findings, especially when sensitive imaging methods are used. Although thyroid cancer is relatively rare, its incidence is increasing, particularly in terms of small tumors, which have an uncertain clinical relevance. Most patients with differentiated thyroid cancer exhibit satisfactory clinical outcomes when treatment is appropriate, and their mortality rate is similar to that of the overall population. However, relapse occurs in a considerable fraction of these patients, and some patients stop responding to conventional treatment and eventually die from their disease. Therefore, the challenge is how to identify the individuals who require more aggressive disease management while sparing the majority of patients from unnecessary treatments and procedures. We have updated the Brazilian Consensus that was published in 2007, emphasizing the diagnostic and therapeutic advances that the participants, representing several Brazilian university centers, consider most relevant in clinical practice. The formulation of the present guidelines was based on the participants' experience and a review of the relevant literature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A case of identical male twins with Cohen syndrome who present multiple ophthalmic findings is reported. The patients were identical 16 year-old twin boys who showed down slanting eyelids, mild ptosis, high-grade myopia, small cortical lens opacities, posterior subcapsular cataracts, myotic and corectopic pupils with poor dilation due to focal iris atrophy and retinochoroidal dystrophy. Ophthalmologists must be aware of the ocular and systemic findings of Cohen syndrome in the evaluation of young patients with mental retardation and visual impairment.