717 resultados para Cocktail of phages


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Low temperatures negatively impact the metabolism of orange trees, and the extent of damage can be influenced by the rootstock. We evaluated the effects of low nocturnal temperatures on Valencia orange scions grafted on Rangpur lime or Swingle citrumelo rootstocks. We exposed six-month-old plants to night temperatures of 20ºC and 8ºC under controlled conditions. After decreasing the temperature to 8ºC, there were decreases in leaf CO2 assimilation, stomatal conductance, mesophyll conductance and CO2 concentration in the chloroplasts, in plant hydraulic conductivity and in the maximum electron transport rate driven ribulose-1,5-bisphosphate (RuBP) regeneration in plants grafted on both rootstocks. However, the effects of low night temperature were more severe in plants grafted on Rangpur rootstock, which also presented reduction in the maximum rate of RuBP carboxylation and in the maximum quantum efficiency of the PSII. In general, irreversible damage due to night chilling was found in the photosynthetic apparatus of plants grafted on Rangpur lime. Low night temperatures induced similar changes in the antioxidant metabolism, preventing oxidative damage in citrus leaves on both rootstocks. As photosynthesis is linked to plant growth, our findings indicate that the rootstock may improve the performance of citrus trees in environments with low night temperatures, with Swingle rootstock improving the photosynthetic acclimation in leaves of orange plants.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The effects of aluminum (Al) on the activities of antioxidant enzymes and ferritin expression were studied in cell suspension cultures of two varieties of Coffea arabica, Mundo Novo and Icatu, in medium with pH at 5.8. The cells were incubated with 300 µM Al3+, and the Al speciation as Al3+ was 1.45% of the mole fraction. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione S-transferase (GST) were increased in Mundo Novo, whereas glutathione reductase (GR) and guaiacol peroxidase (GPOX) activities remained unchanged. SOD, GR, and GST activities were increased in Icatu, while CAT activity was not changed, and GPOX activity decreased. The expression of two ferritin genes (CaFer1 and CaFer2) were analyzed by Real-Time PCR. Al caused a downregulation of CaFER1 expression and no changes of CaFER2 expression in both varieties. The Western blot showed no alteration in ferritin protein levels in Mundo Novo and a decrease in Icatu. The differential enzymes responses indicate that the response to Al is variety-dependent.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To review the literature about the use of atypical antipsychotics in the treatment of pathological aggression in children and adolescents. Method: The databases MEDLINE, SciELO, and LILACS were searched for publications in Portuguese or English from 1992 to August 2011 using the following keywords: mental disease, child, adolescent, treatment, atypical antipsychotic, aggressive behavior, aggression, and violent behavior. Results: Sixty-seven studies of good methodological quality and clinical interest and relevance were identified. Studies including children and adolescents were relatively limited, because few atypical antipsychotics have been approved by the Food and Drug Administration (FDA). All the medications included in this review (risperidone, olanzapine, quetiapine, ziprasidone, aripiprazole and clozapine) have some effectiveness in treating aggression in children and adolescents, and choices should be based on clinical indications and side effects. Conclusions: There are few studies about the effectiveness and safety of atypical antipsychotics for the pediatric population, and further randomized controlled studies with larger groups of patients and more diagnostic categories, such as severe conduct disorder and oppositional defiant disorder, should be conducted to confirm the results reported up to date and to evaluate the impact of long-term use.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION:proctocolectomy with ileal pouch-anal anastomosis (IPAA) is the standard surgical procedure for the treatment of ulcerative colitis (UC) and is associated with the prospect of cure. Experience gained over the years has demonstrated the occurrence of a high number of complications as well as bowel disorders that can compromise quality of life (QoL).OBJECTIVE:evaluate QoL in patients with IPAA for ulcerative colitis.PATIENTS AND METHODS:the Inflammatory Bowel Disease Questionnaire (IBDQ) was used to assess QoL in patients with IPAA after its validation in Portuguese.RESULTS:thirty-one patients submitted to IPAA by the same group of professionals were evaluated. QoL was classified as regular in all domains evaluated (intestinal and systemic symptoms and emotional and social aspects). There were no differences in relation to gender, type of pouch or postoperative time. However, elderly patients showed a tendency toward lower scores. Having a professional activity was associated with higher scores in systemic symptoms and social aspects (p < 0.05). Patients with ileostomy showed lower values in the domains of systemic symptoms, emotional and social aspects (p <0.05).CONCLUSION:in all domains assessed, patients with IPAA for UC had QoL classified as regular. Ileostomy and lack of professional activity negatively influenced QoL.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The XX male syndrome - Testicular Disorder of Sexual Differentiation (DSD) is a rare condition characterized by a spectrum of clinical presentations, ranging from ambiguous to normal male genitalia. We report hormonal, molecular and cytogenetic evaluations of a boy presenting with this syndrome. Examination of the genitalia at age of 16 months, showed: penis of 3.5 cm, proximal hypospadia and scrotal testes. Pelvic ultrasound did not demonstrate Mullerian duct structures. Karyotype was 46,XX. Gonadotrophin stimulation test yielded insufficient testosterone production. Gonadal biopsy showed seminiferous tubules without evidence of Leydig cells. Molecular studies revealed that SRY and TSPY genes and also DYZ3 sequences were absent. In addition, the lack of deletions or duplications of SOX9, NR5A1, WNT4 and NROB1 regions was verified. The infant was heterozygous for all microsatellites at the 9p region, including DMRT1 gene, investigated. Only 10% of the patients are SRY-negative and usually they have ambiguous genitalia, as the aforementioned patient. The incomplete masculinization suggests gain of function mutation in one or more genes downstream to SRY gene.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In 2004, Costa-Santos and cols. reported 24 patients from 19 Brazilian families with 17α-hydroxylase deficiency and showed that p.W406R and p.R362C corresponded to 50% and 32% of CYP17A1 mutant alleles, respectively. The present report describes clinical and molecular data of six patients from three inbred Brazilian families with 17α-hydroxlyse deficiency. All patients had hypogonadism, amenorrhea and hypertension at diagnosis. Two sisters were found to be 46,XY with both gonads palpable in the inguinal region. All patients presented hypergonadotrophic hypogonadism, with high levels of ACTH (> 104 ng/mL), suppressed plasmatic renin activity, low levels of potassium (< 2.8 mEq/L) and elevated progesterone levels (> 4.4 ng/mL). Three of them, including two sisters, were homozygous for p.W406R mutation and the other three (two sisters and one cousin) were homozygous for p.R362C. The finding of p.W406R and p.R362C in the CYP17A1 gene here reported in additional families, confirms them as the most frequent mutations causing complete combined 17α-hydroxylase/17,20-lyase deficiency in Brazilian patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant hereditary cancer syndrome characterized mostly by parathyroid, enteropancreatic, and anterior pituitary tumors. We present a case of an 8-year-old boy referred because of hypoglycemic attacks. His diagnosis was pancreatic insulinoma. Paternal grandmother died due to repeated gastroduodenal ulcerations and a paternal aunt presented similar manifestations. At a first evaluation, the father presented only gastric ulceration but subsequently developed hyperparathyroidism and lung carcinoid tumor. During almost 15 years of follow-up, three brothers and the index case presented hyperparathyroidism and hyperprolactinemia. Molecular study showed a G to A substitution in intron 4, at nine nucleotides upstream of the splicing acceptor site, causing a splicing mutation. All affected members of the family have the same mutation. Paternal grandmother and aunt were not studied and the mother does not carry any mutation. MEN1 is a rare condition that requires permanent medical assistance. Early clinical and genetic identification of affected individuals is essential for their own surveillance and also for genetic counseling.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Type II 3β-hydroxysteroid dehydrogenase/Δ5-Δ4-isomerase (3β-HSD2), encoded by the HSD3B2 gene, is a key enzyme involved in the biosynthesis of all the classes of steroid hormones. Deleterious mutations in the HSD3B2 gene cause the classical deficiency of 3β-HSD2, which is a rare autosomal recessive disease that leads to congenital adrenal hyperplasia (CAH). CAH is the most frequent cause of ambiguous genitalia and adrenal insufficiency in newborn infants with variable degrees of salt losing. Here we report the molecular and structural analysis of the HSD3B2 gene in a 46,XY child, who was born from consanguineous parents, and presented with ambiguous genitalia and salt losing. The patient carries a homozygous nucleotide c.665C>A change in exon 4 that putatively substitutes the proline at codon 222 for glutamine. Molecular homology modeling of normal and mutant 3β-HSD2 enzymes emphasizes codon 222 as an important residue for the folding pattern of the enzyme and validates a suitable model for analysis of new mutations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: Evaluate the efficacy of cumulative doses (CDs) of 131I-iodide therapy (RIT) in differentiated thyroid cancer (DTC). SUBJECTS AND METHODS: The probability of progressive disease according to CDs was evaluated in patients < 45 years old and > 45 years old and correlated to tumor-node-metastasis (TNM), thyroglobulin values, histological types and variants, age, and zduration of the disease. RESULTS: At the end of a follow-up period of 69 ± 56 months, 85 out of 150 DTC patients submitted to fixed doses RIT had no evidence of disease, 47 had stable disease and 18 had progressive disease. Higher CDs were used in the more aggressive variants (p < 0.0001), higher TNM stages (p < 0.0001), and follicular carcinomas (p = 0.0034). Probability of disease progression was higher with CDs > 600 mCi in patients > 45 years old and with CDs > 800 mCi in patients < 45 years. CONCLUSION: Although some patients may still respond to high CDs, the impact of further RIT should be carefully evaluated and other treatment strategies may be warranted.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Disorders of sex development (DSD) involve several conditions that result from abnormalities during gonadal determination and differentiation. Some of these disorders may manifest at birth by ambiguous genitalia; others are diagnosed only at puberty, by the delayed onset of secondary sexual characteristics. Sex determination and differentiation in humans are processes that involve the interaction of several genes such as WT1, NR5A1, NR0B1, SOX9, among others, in the testicular pathway, and WNT4, DAX1, FOXL2 and RSPO1, in the ovarian pathway. One of the major proteins in mammalian gonadal differentiation is the steroidogenic nuclear receptor factor 1 (SF1). This review will cover some of the most recent data on SF1 functional roles and findings related to mutations in its coding gene, NR5A1.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: To evaluate insulin resistance and lipid profile in women with congenital adrenal hyperplasia (CAH) caused by classical 21-hydroxylase deficiency (21OHD), and their association with body mass index (BMI) and corticosteroid dosage. SUBJECTS AND METHODS: We assessed BMI, waist circumference, current glucocorticoid dosage, glucose, insulin and lipid profile in eighteen young women (mean ± SD, 19.3 ± 3.0 years) with 21OHD CAH. RESULTS: BMI was normal in 12 patients, 5 of them were overweight, and 1 was obese. Waist circumference was high in 7 patients. Fasting insulin and HOMA-IR were elevated in seven and eight patients, respectively. Total cholesterol and triglycerides were high in only two patients, and HDL-cholesterol was low in four. Insulin resistance was not associated with BMI, waist circumference or glucocorticoid dose. CONCLUSIONS: Young women with 21OHD CAH had infrequent dyslipidemia, but had a higher prevalence of insulin resistance and central obesity, that were independent of BMI or corticosteroid dosage.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: To screen for mutations in AMH and AMHR2 genes in patients with persistent Müllerian duct syndrome (PMDS). PATIENTS AND METHOD: Genomic DNA of eight patients with PMDS was obtained from peripheral blood leukocytes. Directed sequencing of the coding regions and the exon-intron boundaries of AMH and AMHR2 were performed. RESULTS: The AMH mutations p.Arg95*, p.Arg123Trp, c.556-2A>G, and p.Arg502Leu were identified in five patients; and p.Gly323Ser and p.Arg407* in AMHR2 of two individuals. In silico analyses of the novel c.556-2A>G, p.Arg502Leu and p.Arg407* mutations predicted that they were harmful and were possible causes of the disease. CONCLUSION: A likely molecular etiology was found in the eight evaluated patients with PMDS. Four mutations in AMH and two in AMHR2 were identified. Three of them are novel mutations, c.556-2A>G, and p.Arg502Leu in AMH; and p.Gly323Ser in AMHR2. Arq Bras Endocrinol Metab. 2012;56(8):473-8

Relevância:

20.00% 20.00%

Publicador:

Resumo:

FISH has been used as a complement to classical cytogenetics in the detection of mosaicism in sex chromosome anomalies. The aim of this study is to describe three cases in which the final diagnosis could only be achieved by FISH. Case 1 was an 8-year-old 46,XY girl with normal female genitalia referred to our service because of short stature. FISH analysis of lymphocytes with probes for the X and Y centromeres identified a 45,X/46,X,idic(Y) constitution, and established the diagnosis of Turner syndrome. Case 2 was a 21-month-old 46,XY boy with genital ambiguity (penile hypospadias, right testis, and left streak gonad). FISH analysis of lymphocytes and buccal smear identified a 45,X/46,XY karyotype, leading to diagnosis of mixed gonadal dysgenesis. Case 3 was a 47,XYY 19-year-old boy with delayed neuromotor development, learning disabilities, psychological problems, tall stature, small testes, elevated gonadotropins, and azoospermia. FISH analysis of lymphocytes and buccal smear identified a 47,XYY/48,XXYY constitution. Cases 1 and 2 illustrate the phenotypic variability of the 45,X/46,XY mosaicism, and the importance of detection of the 45,X cell line for proper management and follow-up. In case 3, abnormal gonadal function could be explained by the 48,XXYY cell line. The use of FISH in clinical practice is particularly relevant when classical cytogenetic analysis yields normal or uncertain results in patients with features of sex chromosome aneuploidy. Arq Bras Endocrinol Metab. 2012;56(8):545-51