Flow injection green method for the quantitative analysis of ketoconazole in pharmaceutical preparations

A flow injection method for the quantitative analysis of ketoconazole in tablets, based on the reaction with iron (III) ions, is presented. Ketoconazole forms a red complex with iron ions in an acid medium, with maximum absorbance at 495 nm. The detection limit was estimated to be 1×10--4 mol L-1; the quantitation limit is about 3×10--4 mol L-1 and approximately 30 determinations can be performed in an hour. The results were compared with those obtained with a reference HPLC method. Statistical comparisons were done using the Student's t procedure and the F test. Complete agreement was found at the 0.95 significance level between the proposed flow injection and the HPLC procedures. The two methods present similar precision, i.e., for HPLC the mean relative standard deviation was ca. 1.2% and for FIA ca. 1.6%.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Analysis of anti-Müllerian hormone (AMH) and its receptor (AMHR2) genes in patients with persistent Müllerian duct syndrome

OBJECTIVE: To screen for mutations in AMH and AMHR2 genes in patients with persistent Müllerian duct syndrome (PMDS). PATIENTS AND METHOD: Genomic DNA of eight patients with PMDS was obtained from peripheral blood leukocytes. Directed sequencing of the coding regions and the exon-intron boundaries of AMH and AMHR2 were performed. RESULTS: The AMH mutations p.Arg95*, p.Arg123Trp, c.556-2A>G, and p.Arg502Leu were identified in five patients; and p.Gly323Ser and p.Arg407* in AMHR2 of two individuals. In silico analyses of the novel c.556-2A>G, p.Arg502Leu and p.Arg407* mutations predicted that they were harmful and were possible causes of the disease. CONCLUSION: A likely molecular etiology was found in the eight evaluated patients with PMDS. Four mutations in AMH and two in AMHR2 were identified. Three of them are novel mutations, c.556-2A>G, and p.Arg502Leu in AMH; and p.Gly323Ser in AMHR2. Arq Bras Endocrinol Metab. 2012;56(8):473-8

Comparative analysis of the new guidelines and consensuses for the management of hypothyroidism, thyroid nodules, and differentiated thyroid cancer

233

Aspectos epidemiologicos das lesões desportivas no voleibol

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise do perfil de humor e da enzima alfa-amilase salivar em indivíduos fisicamente ativos = : Analysis of profile of mood states and salivary alpha amylase enzyme in physically active individuals

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise do desempenho muscular do quadríceps e dos isquiotibiais em função da série temporal e da amplitude de movimento de atletas amadoras de futsal feminino = : Analysis of muscle performance of the quadriceps and hamstrings as a function of the times series and range of motion of amateurfemale futsal athletes

Universidade Estadual de Campinas . Faculdade de Educação Física

Escala de autoaceitação para pessoas com cegueira congênita ou precoce : desenvolvimento e investigação psicométrica = Self-acceptance acale for people with congenital or early blindness : development and psychometric analysis

Universidade Estadual de Campinas . Faculdade de Educação Física

O aluno com deficiência visual nas aulas de educação física : análise do processo inclusivo = The student with visual impairments : analysis of inclusive process

Universidade Estadual de Campinas . Faculdade de Educação Física

Possibilidades e limites da avaliação da qualidade de vida : análise dos instrumentos WHOQOL e modelos clássicos de qualidade de vida no trabalho = Possibilities and limits of quality of life assessment : analysis of WHOQOL instruments and quality of work life classical models

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise transversal da estrutura óssea e parâmetros hematológicos em futebolistas profissionais = : Cross-sectional analysis of bone structure and hematological parameters in professional soccer players

Universidade Estadual de Campinas. Faculdade de Educação Física

Calibração de câmeras para análises subaquáticas de movimentos = : Cameras calibration for underwater motion analysis

Universidade Estadual de Campinas . Faculdade de Educação Física

Proposição de um método de análise de movimentos de jogadores de tênis de campo a partir de vídeos televisivos = : Proposition of a method for tennis players motion analysis on broadcast videos

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise do desempenho em testes de triathlon com diferentes intensidades durante a etapa natação = : Analysis of triathlon trials performance using different intensities during swimming phase

Universidade Estadual de Campinas . Faculdade de Educação Física