O comportamento de crianças durante atendimento odontológico

This research intended to investigate the use of diazepam in conjunction with behavioral strategies to manage uncooperative behavior of child dental patients. The 6 participants received dental treatment during 9 sessions. Using a double-blind design, children received placebo or diazepam and at the same time were submitted to behavior management produces (distraction, explanation, reinforcement and set rule and limits). All sessions were recorded in video-tapes biped in 15 seconds intervals, in which observers recorded child's (crying, body and/or head movements, escape and avoidance) and dentist's behavior. The results indicated that diazepam, considering the used dose, was only effective with one subject. The other participants didn't permit the treatment and showed an increase in their resistance. The behavioral preparation strategies for dental treatment should have been more precisely planned in order to help the child to face the real dental treatment conditions mainly in the first sessions avoiding to reinforce inappropriate behaviors.

Aprendizagem autorregulada da leitura: resultados positivos de uma intervenção psicopedagógica

The purpose of this study was to evaluate the effects of a pedagogical intervention to improve the reading comprehension of fourth grade students of a public primary school. Two classes of 28 students were randomly assigned to an experimental or control group. The students were assessed during three different moments by means of an informative questionnaire, a Learning Strategies Scale and two cloze tests for reading comprehension. The intervention consisted of seven sessions which included learning strategies instruction, reading strategies instruction, meta-cognition activation, motivational support and study guidance. Results showed improvement in meta-cognition and in reading comprehension in both groups. However, gains were higher and more consistent in the experimental group.

Folhas verdes, folhas secas, fibra do colmo e a clarificação do caldo de cana-de-açúcar

The presence of vegetal impurities in sugarcane delivered to sugarmills as green and dry leaves is a problem not only because they are non-value materials to be processed along with sugarcane stalks, but also because they can rise the color of the clarified juice and, consequently, the color of the sugar produced, with a reduction of its quality for the market. Another problem is the mud volume sedimented in the clarifiers, which also can result in a larger recirculation and greater volume of filtrate juice, with higher losses of sucrose and utilization of the vacuum rotary filters. The objective of this work was to observe the effect of the presence of green and dry leaves on sugarcane juice clarification, related to a control treatment with the addition of fiber extracted from the stalks. The experiments were planned based on the addition of quantities of fibrous sources in order to formulate samples with absolute increase of 0.25 , 0.50 and 0.75 percentual points over the fiber content of the sugarcane stalks (control treatment). The juice clarification was conducted with a laboratory clarifier. The clarified juice color and the mud volume were evaluated. The presence of green leaves caused higher color and mud volume due to the extraction of non-sucrose components of the leaves. Soluble compounds of dry leaves were also extracted, though not detected by juice analysis. The addition of the fiber extracted from the stalks did not induce alterations in the clarification process.

Atributos mecânicos e erosão por salpicamento em amostras de latossolo vermelho-amarelo sob efeito de vinhaça

The objective of this study was to quantify the effect of plonk on compressive behavior and mechanical attributes such as consistency, optimum moisture for compaction and maximum density of a Red-Yellow Latosol (Oxisol) to evaluate the effect of plonk and compaction state in splashed particles, from Lavras (MG) region. The plonk was obtained from an artisanal sugarcane brandy alembic. Undisturbed and disturbed soil samples were collected at 0 to 3 cm and 60 to 63 cm depths. Disturbed soil samples were used for soil characterization, determination of consistence limits and Normal Proctor essay after material incubation with plonk. Undisturbed soil samples were saturated with plonk or distilled water (control) during 48 hours for testing the compressibility and resistance to splash by using simulated rainfall. The plonk altered the consistence limits of studied layers. For the 0-3 cm layer, the plonk reduced the friable range, and for the 60-63 cm layer the effect was in the opposite direction. For both layers, the plonk increased Dmax and decreased Uoptimum. Regardless of the plonk treatment, both layers presented the same load support capacity. The compaction degree of samples influenced the splash erosion. The increase of the applied pressure over the samples resulted in increase of splash material quantity. At the 60-63 cm layer, the plonk treatment reduced the splash material quantity by increasing the applied pressure, mainly when the samples were at field capacity.

Estudo inicial da degradação in vivo de poli(L-co-D,L ácido lático), sintetizado em laboratório, aplicado como prótese tibial em coelhos

The copolymer poly (L-co-D,L lactic acid), PLDLA, has gained prominence in the field of temporary prostheses due to the fact that their time of degradation is quite compatible with the requirement in the case of osseous fracture. In this work the in vivo degradation of devices from copolymer, as a system of plates and screws, used in fixation of the tibia of rabbits was studied. The devices were implanted in 15 adult rabbits, albinos, New Zealand race, and they were used as control devices of alloys of titanium (Ti-6Al-4V/ V grade). The use of copolymers, synthesized in the laboratory, was tested in the repair of fracture in rabbits'tibias, being assessed in the following times: 2 weeks, 2 months and 3 months. Morphological analysis of tissue surrounding the plate and screw system, for 2 weeks of implantation, showed the presence of osteoblasts, indicating a pre bone formation. After 2 months there was new bone formation in the region in contact with the polymer. This bone growth occurred simultaneously with the process of PLDLA degradation, invading the region where there was polymer and after 3 months there was an intense degradation of the copolymer and hence greater tissue invasion compared to 2 months which characterized bone formation in a region where the polymer degraded. The in vivo degradation study of the devices for PLDLA by means of histological evaluations during the period of consolidation of the fracture showed the efficiency of plate and screw system, and it was possible to check formation of bone tissue at the implantation site, without the presence of inflammatory reaction

Medo, ansiedade e controle relacionados ao tratamento odontológico

The aim of this study was to test fear, anxiety and control related to dental treatment. The subjects were 364 children with ages between 7 and 13 years. Three questionnaires with multiple choice questions were applied in groups of 10 children. The first instrument was the 15-item dental subscale from the Children’s Fear Survey Schedule9. The subjects rated their level of fear on a 5-point scale. The second survey instrument was the 20-item subscale from the State Trait Anxiety Inventory for Children16. This measure was used to capture how anxious the child was, in general. The third instrument was the Child Dental Control Assessment19. It contained 20 items to assess perceived control and 20 items to assess desired control. The results of the survey indicated that dental fear and anxiety were slightly higher for females when compared with male subjects (P < 0.05). Older children (11 to 13 years old) obtained higher fear scores than younger ones (7 to 9 years old). Concerning perceived control, the results indicate that younger children perceive more control than older ones. For desired control, the results indicate that younger children reported higher percentages than older ones. In this study, patients who had undergone anesthesia during treatment revealed higher fear scores when compared with those who had not. Dental fear etiology seems to be related to a procedure that may involve pain or lack of control.

Rugosidade e pigmentação superficial de materiais ionoméricos

The aim of this study was to compare two methods of surface roughness analysis, perfilometry and spectrophotometry, applied to the surface of ionomeric materials (Chelon Fil, Vitremer and Dyract), submitted to different surface finishing treatments. For the perfilometric analysis, sixty specimens of each material were made and randomly separated into three experimental groups. The average surface roughness (Ra, mm) was measured on each specimen by a surface perfilometer (Mitutoyo Surftest 211). The spectrophotometric analysis consisted in quantifying the dye impregnated in the samples. The dyes used were 0.5% fuchsin and 0.5% erythrosin. Data were submitted to variance analysis (ANOVA) and t-Student test at a 0.05 significance level. There was no linear correlation between average roughness and superficial deposition of dye. Perfilometric analysis revealed that 12- and 30-bladed carbide burs caused the roughest surface of Chelon Fil, followed by Sof-Lex discs and mylar band. There were no significant differences between the specimens submitted to finishing and polishing with Sof-Lex discs and the control group (mylar band) for Vitremer, nevertheless, the highest Ra values were obtained when 12- and 30-bladed burs were used. For Dyract, there was no significant difference between the three treatments. The mean values of superficial deposition of dye for Chelon Fil, Vitremer and Dyract were: 1.7261, 1.4759, 1.3318, respectively. There were no significant differences between the restorative materials when different finishing and polishing systems were used.

Metformina interage com o treinamento físico diminuindo a glicemia e aumentando o armazenamento de glicogênio em ratos diabéticos

INTRODUCTION: Like in humans, lower amounts of glycogen are present in tissues of diabetic rats. However, training or drugs that lower glycemia can improve the metabolic control. Metformin increased glycogen while decreased glycemia in normal rats stressed by exercise. OBJECTIVE: In this work we investigated if regular exercise and metformin effects improve the metabolism of diabetic rats. METHODS: Alloxan diabetic Wistar rats treated with metformin (DTM) or not (DT) were trained. Training consisted of 20 sessions of 30 min, 5 days a week. Sedentary diabetic rats served as control (SD and SDM). Metformin (5.6 µg/g) was given in the drinking water. After 48 h resting, glucose (mg/dl) and insulin (ng/mL) was measured in plasma and glycogen (mg/100 mg of wet tissue) in liver, soleus and gastrocnemius. RESULTS: Glycemia decreased in DM group from 435±15 to 230±20, in DT group to 143±8.1 and in DTM group to 138±19 mg/dl. DM group had proportional increase in the hepatic glycogen from 1.69±0.22 to 3.53±0.24, and the training increased to 3.36 ± 0.16 mg/100 mg. Metformin induced the same proportional increase in the muscles (soleus from 0.21±0.008 to 0.42±0.03 and gastrocnemius from 0.33±0.02 to 0.46±0.03), while the training promoted increase on gastrocnemius to 0,53 ± 0,03, only. A high interaction was observed in liver (glycogen increased to 6.48±0.34). CONCLUSION: Very small oral doses of metformin and/or, partially restored glycemia in diabetic rats and decreased glycogen in tissues. Its association with an exercise program was beneficial, helping lower glycemia further and increase glycogen stores on liver of diabetic rats.

Avaliação do amaciamento de carne bovina de dianteiro (Triceps brachii) pelos métodos de maturação, estimulação elétrica, injeção de ácidos e tenderização mecânica

Twenty-two Triceps brachii muscle obtained from 11 cows aged 3 and 4 years , killed in an experimental slaughter plant, were submitted to mechanical tenderization, injection with acetic acid 0,1M and lactic acid 0,2M, ageing for 9 and 14 days and electrical stimulation (250v - 60Hz - 90s), some of them were reserved as a control group, without treatment. The 14 days ageing time presented 21% of increase in subjective tenderness and 12% of reduction in shear force, these values were similar to the electrical stimulated meat. However the injection with acids and the ageing time 9 days did not present significant effect in the texture. Although the shear force values of mechanical tenderized meat was the shortest among all treatments, suspect of superestimation because of the fractures plan created by this process. Another analyses were carried out: pH reduction curve, R value; colour analysis; weight losses by cooking and by treatment; and microbiological analysis.

Hidrocarbonetos aromáticos policíclicos em margarina, creme vegetal e maionese

Polycyclic aromatic hydrocarbons (PAHs) are a group of compounds that have been the subject of much concern due to their toxic potential. In this study, margarine?s, vegetable cream and mayonnaise available on the Brazilian market were analyzed for pyrene, chrysene, benzo(a)pyrene, benzo(b)fluoranthene and dibenzo(a,h)anthracene. The analytical methodology involved liquid-liquid extraction, clean-up on silica gel column and determination by high performance liquid chromatography using fluorescence detector. Variable levels of contamination were found within differents brands of the same product and within differents batches of the same brand. The total PAH content was in the range of 4.1 to 7.1mug/kg in vegetable cream, 1.7 to 3.9mug/kg in margarine and 1.0 to 21.7mug/kg in mayonnaise. In general the products which according to the label contain corn oil showed the highest levels of contamination. Based on these results and on the importance of fat, oils and derived products for the intake of PAHs, it is recommended that producers of margarine, vegetable creams and mayonnaise start to control the contamination of the vegetable oils used in the elaboration of these products, in order to reduce the exposure of consumers to excessive amounts of potentially carcinogenic compounds.

Behaviour of albino and melanic variants of Biomphalaria glabrata Say, 1818 (Mollusca: Planorbidae) following infection by Schistosoma mansoni Sambon, 1907

The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.

Evaluation of the cytotoxic and genotoxic potential of water from the River Paraíba do Sul, in Brazil, with the Allium cepa L. test

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Crescimento e composição corporal de uma coorte de crianças e adolescentes com diabetes tipo 1

OBJECTIVE: To evaluate the growth and body composition of children and adolescents with type 1 diabetes mellitus (T1DM). SUBJECTS AND METHODS: A cohort of 44 patients with T1DM were followed up for approximately four years and compared with a control group. Weight, height, body mass index (BMI), body fat percentage (BF%), fat mass index, waist circumference (WC) and waist-height ratio were determined. RESULTS: In females, in the first evaluation, BF% was lower in patients than in controls, while in the second evaluation, mean WC was higher in patients than in controls. In males, height of the patients was lower in the first evaluation, while body mass index (BMI) was higher in the second one. We did not find any differences among the changes in height, weight and BMI z-scores and BF% or in the distribution of those z-scores between the two evaluations, in both groups. Multiple regression analysis found differences in BMI and waist-height ratio in both sexes and also in WC in females. CONCLUSION: The patients had adequate growth but showed discrepancy in their body composition during the study.

O uso da mitomicina C em cirurgia combinada

Purpose: To analyze the efficacy and safety of intraope-rative mitomycin C (MMC) in combined procedures (extra-capsular cataract extraction + trabeculectomy). Methods: Twenty-four patients were randomized to either MMC (0.5 mg/ml) (n = 14) or saline solution (n = 10) for 3 minutes during the combined procedure. Results: Twelve months after surgery, mean IOP in the MMC group (13.2 ± 2.9 mmHg) was significantly lower than in the control group (16.3 ± 3.9 mmHg) (p = 0.02). The mean number of medications used during the 12-month follow-up in the control group (1.33 ± 0.5) was significantly higher than in the MMC-treated group (0.5 ± 0.5) (p = 0.005). Life table analysis showed a significantly higher probability of IOP control in the MMC group than in the control group (p < 0.01). Conclusions: Intraoperative MMC is safe and effective in pro-moting a better IOP control and reducing the need for postoperative antiglaucoma medications. We suggest intraope-rative MMC to be routinely employed in combined procedures.