Insegurança alimentar em domicílios brasileiros com crianças menores de cinco anos

This article analyzes food insecurity and hunger in Brazilian families with children under five years of age. This was a nationally representative cross-sectional study using data from the National Demographic and Health Survey on Women and Children (PNDS-2006), in which the outcome variable was moderate to severe food insecurity, measured by the Brazilian Food Insecurity Scale (EBIA). Prevalence estimates and prevalence ratios were generated with 95% confidence intervals. The results showed a high prevalence of moderate to severe food insecurity, concentrated in the North and Northeast regions (30.7%), in economic classes D and E (34%), and in beneficiaries of conditional cash transfer programs (36.5%). Multivariate analysis showed that the socioeconomic relative risks (beneficiaries of conditional cash transfers), regional relative risks (North and Northeast regions), and economic relative risks (classes D and E) were 1.8, 2.0 and 2.4, respectively. Aggregation of the three risks showed 48% of families with moderate to severe food insecurity, meaning that adults and children were going hungry during the three months preceding the survey.

Estilos motivacionais de professores: propriedades psicométricas de um instrumento de avaliação

The purpose of this study was to conduct an exploratory factorial analysis of Problems in School, a teachers' motivational styles evaluation instrument, constructed by Deci et al. The original instrument is in a Likert-scale format with the underlying assumption of the existence of a continuum of four different styles contributing to promote students' autonomy. Translated into portuguese, the instrument was applied to 582 elementary and junior high school teachers from several regions of Brazil. Factorial analyses revealed a solution with four orthogonal distinct factors, the authors' initial supposition (existence of a continuum) was not confirmed. In fact, only two opposite styles (both high promotion of autonomy and of control) corresponded to the Deci et al. original ideas. Problems regarding the validity of the other remaining styles emerged. Data was discussed and a revised version of the scale was developed. Directions for further research were also suggested.

A construção de uma escala de estratégias de aprendizagem para alunos do ensino fundamental

Although learning strategies are important tools for schooling process, there is a lack of national instruments to evaluate their knowledge by brazilian students. Therefore, the objectives of this paper are to describe the steps necessary for the construction of a scale to evaluate the learning strategies for basic education students and to present the preliminary study of its psychometric properties. It is also discussed the utility of this instrument for diagnosis, intervention and prevention in school and educational psychology.

Estratégias de aprendizagem e desempenho acadêmico: evidências de validade

The purpose of the present study was to verify the factorial validity of a learning strategy scale as well as to explore the concurrent validity of the instrument in regard to students´ academic achievement. The sample was composed of 815 basic education children from both public and private schools of São Paulo and Minas Gerais. The Learning Strategy Scale was collectively applied. Exploratory factorial analyses were conducted to achieve the purposes of the study. The alphas of Cronbach of the instrument and of its three subscales showed good reliability. Variance analyses showed significant differences between school achievement and punctuation in the scale. The data were discussed in terms of their possible implications for the psycho-educational evaluation area.

Aprendizagem autorregulada da leitura: resultados positivos de uma intervenção psicopedagógica

The purpose of this study was to evaluate the effects of a pedagogical intervention to improve the reading comprehension of fourth grade students of a public primary school. Two classes of 28 students were randomly assigned to an experimental or control group. The students were assessed during three different moments by means of an informative questionnaire, a Learning Strategies Scale and two cloze tests for reading comprehension. The intervention consisted of seven sessions which included learning strategies instruction, reading strategies instruction, meta-cognition activation, motivational support and study guidance. Results showed improvement in meta-cognition and in reading comprehension in both groups. However, gains were higher and more consistent in the experimental group.

Tissue culture of Cecropia glaziovii Sneth (urticaceae): vegetative micropropagation and plant regeneration from callus

Cecropia glaziovii is a tree with used in Brazilian popular medicine. Methods allowing the clonal propagation of this species are of great interest for superior genotype multiplication and perpetuation. For this reason, we examined the effect of different culture media and different types of explants on adventitious shoot regeneration from callus and buds of C. glaziovii. Leaves, petioles and stipules obtained from aseptically grown seedlings or from pre-sterilized plants were used to initiate cultures. Adventitious shoot regeneration was achieved when apical and axillary buds were inoculated on gelled Murashige & Skoog (MS) medium supplemented with 6-benzylaminopurine alone (BAP) (1.0, 5.0 or 10.0 mg L-1) or combined with -naphthalene acetic acid (NAA) (1.0 or 2.0 mg L-1), after 40 days of culture. Best callus production was obtained after 30 days of petioles' culture on gelled MS medium with 2,4 dichlorophenoxyacetic acid (2,4-D) (5.0 mg L-1) combined with BAP (1.0 mg L-1). Successful shoot regeneration from callus was achieved when MS medium supplemented with zeatin (ZEA) (0.1 mg L-1) alone or combined with 2,4-D (1.0 or 5.0 mg L-1) was inoculated with friable callus obtained from petioles. All shoots were rooted by inoculation on MS medium supplemented with indole-3-acetic acid (IAA) (1.0 mg L-1). Rooted plants transferred to potting soil were successfully established. All in vitro regenerated plantlets showed to be normal, without morphological variations, being also identical to the source plant. Our study has shown that C. glaziovii can be propagated by tissue culture methods, allowing large scale multiplication of superior plants for pharmacological purposes.

Medo, ansiedade e controle relacionados ao tratamento odontológico

The aim of this study was to test fear, anxiety and control related to dental treatment. The subjects were 364 children with ages between 7 and 13 years. Three questionnaires with multiple choice questions were applied in groups of 10 children. The first instrument was the 15-item dental subscale from the Children’s Fear Survey Schedule9. The subjects rated their level of fear on a 5-point scale. The second survey instrument was the 20-item subscale from the State Trait Anxiety Inventory for Children16. This measure was used to capture how anxious the child was, in general. The third instrument was the Child Dental Control Assessment19. It contained 20 items to assess perceived control and 20 items to assess desired control. The results of the survey indicated that dental fear and anxiety were slightly higher for females when compared with male subjects (P < 0.05). Older children (11 to 13 years old) obtained higher fear scores than younger ones (7 to 9 years old). Concerning perceived control, the results indicate that younger children perceive more control than older ones. For desired control, the results indicate that younger children reported higher percentages than older ones. In this study, patients who had undergone anesthesia during treatment revealed higher fear scores when compared with those who had not. Dental fear etiology seems to be related to a procedure that may involve pain or lack of control.

Avaliação da aceitação de vinhos brancos varietais brasileiros através de testes sensoriais afetivos e técnica multivariada de mapa de preferência interno

The acceptability of nine commercial brazilian varietal white table wines (Riesling, Chardonnay and Gewürztraminer) was evaluated using sensory affective tests. The samples were assessed by 43 consumers of brazilian white wines using he nine-point structured hedonic scale. Judges were recruited based on their responses to a questionnary about consumer?s behavior towards white wines consumption. Subsequently, Analysis of Variance (ANOVA) with means comparision (Tukey test) and Internal Analysis of Preference Mapping (MDPREF) were performed on data. Analysis of Variance showed that two samples (a Riesling and a Gewürztraminer, both sweet table wines) had significantly (p < 0.05) higher acceptance means, around 7 in the hedonic scale. The least acceptance means (4,3) was obtained by a demi-sec Chardonnay wine and the other six samples achieved means around 5 in the hedonic scale, all of them either demi-sec or dry table wines. MDPREF confirmed the results showed by ANOVA showing that samples were segmented into two groups of preference. The first group was composed by 86% of consumers who prefered the sweet table wines (higher acceptance), converging to the region on the map where these samples were represented. Only 14% showed preference for the demi-sec and dry table wines, being represented on the region of the MDPREF where these samples were located. This study suggests that sweet table wines are prefered by Brazilian consumers, instead of dry or demi-sec table wines.

Perfil sensorial de ovos de Páscoa

Easter egg is a popular chocolate-candy in egg form commercialized in Brazil during Easter time. In this research, Quantitative Descriptive Analysis was applied to select sensory attributes which best define the modifications in appearance, aroma, flavor and texture when cocoa butter equivalent (CBE) is added to Easter eggs. Samples with and without CBE were evaluated by a selected panel and fourteen attributes best describing similarities and differences between them, were defined. Terms definition, reference materials and a consensus ballot were developed. After a training period, panelists evaluated the samples in a Complete Block Design using a 9 cm unstructured scale. Principal Component Analysis, ANOVA and Tukey test (p<0.05) were applied to the data in order to select attributes which best discriminated and characterized the samples. Samples showed significant differences (p<0.05) in all attributes. Easter egg without CBE showed higher intensities (p<0.05) in relation to the following descriptors: brown color, characteristic aroma, cocoa mass aroma, cocoa butter aroma, characteristic flavor, cocoa mass flavor, hardness and brittleness.

Perfil sensorial de vinhos brancos varietais brasileiros através de análise descritiva quantitativa

Descriptive terminology and sensory profile of three varieties of brazilian varietal white wines (cultivars Riesling, Gewürztraminer and Chardonnay) were developed by a methodology based on the Quantitative Descriptive Analysis (QDA). The sensory panel consensually defined the sensory descriptors, their respective reference materials and the descriptive evaluation ballot. Ten individuals were selected as judges based on their discrimination, reproducibility and individual consensus with the sensory panel. Twelve descriptors were generated showing similarities and differences among the wine samples. Each descriptor was evaluated using a nine-centimeters non-structured scale with the intensity terms anchored at its ends. The collected data were analysed by ANOVA, Tukey test and Principal Component Analysis (PCA). The results showed a great difference within the sensory profile of Riesling and Gewürztraminer wines, whereas Chardonnay wines showed a lesser variation. PCA separated samples into two groups: a first group formed by wines higher in sweetness and fruitty flavor and aroma; and a second group of wines higher in sourness, adstringency, bitterness, alcoholic and fermented flavors.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Phenotypic variability in a family with x-linked adrenoleukodystrophy caused by the p.Trp132Ter mutation

X-linked adrenoleukodystrophy (X-ALD) is an inherited disease with clinical heterogeneity varying from presymptomatic individuals to rapidly progressive cerebral ALD forms. This disease is characterized by increased concentration of very long chain fatty acids (VLCFAs) in plasma and in adrenal, testicular and nervous tissues. Affected individuals can be classified in different clinical settings, according to phenotypic expression and age at onset of initial symptoms. Molecular defects in X-ALD individuals usually result from ABCD1 gene mutations. In the present report we describe clinical data and the ABCD1 gene study in two boys affected with the childhood cerebral form that presented with different symptomatic manifestations at diagnosis. In addition, their maternal grandfather had been diagnosed with Addison's disease indicating phenotypic variation for X-ALD within this family. The mutation p.Trp132Ter was identified in both male patients; additionally, three females, out of eleven family members, were found to be heterozygous after screening for this mutation. In the present report, the molecular analysis was especially important since one of the heterozygous females was in first stages of pregnancy. Therefore, depending on the fetus outcome, if male and p.Trp132Ter carrier, storage of the umbilical cord blood should be recommended as hematopoietic stem cell transplantation could be considered as an option for treatment in the future.

Structural aspects of the p.P222Q homozygous mutation of HSD3B2 gene in a patient with congenital adrenal hyperplasia

Type II 3β-hydroxysteroid dehydrogenase/Δ5-Δ4-isomerase (3β-HSD2), encoded by the HSD3B2 gene, is a key enzyme involved in the biosynthesis of all the classes of steroid hormones. Deleterious mutations in the HSD3B2 gene cause the classical deficiency of 3β-HSD2, which is a rare autosomal recessive disease that leads to congenital adrenal hyperplasia (CAH). CAH is the most frequent cause of ambiguous genitalia and adrenal insufficiency in newborn infants with variable degrees of salt losing. Here we report the molecular and structural analysis of the HSD3B2 gene in a 46,XY child, who was born from consanguineous parents, and presented with ambiguous genitalia and salt losing. The patient carries a homozygous nucleotide c.665C>A change in exon 4 that putatively substitutes the proline at codon 222 for glutamine. Molecular homology modeling of normal and mutant 3β-HSD2 enzymes emphasizes codon 222 as an important residue for the folding pattern of the enzyme and validates a suitable model for analysis of new mutations.

Efeito neuromuscular das técnicas fisioterapeuticas bandagem funcional e corrente interferencial na síndrome tensional cervical

Universidade Estadual de Campinas . Faculdade de Educação Física

Qualidade de vida e nivel de atividade fisica de funcionarios de empresa de tecnologia da comunicação

Universidade Estadual de Campinas . Faculdade de Educação Física