60 resultados para Leonardo, da Vinci, 1452-1519


Relevância:

10.00% 10.00%

Publicador:

Resumo:

This article has the aim to expand the perspective of research in the field of morality. We present a proposal of morality study of outlaw teenagers according to Thinking Organizer Models Theory. Through the idea of complexity we search to understand the cognitive process in the elaboration of moral reasoning inside situations of conflict. With this perspective, we developed a research that aimed to identify which organizer models were applied by 20 outlaw male teenagers who abide by social punishment to solve the hypothetical moral conflicts. Through interviews we told them a situation of moral conflict that involved friendship relation, physical aggression and steal. We could identified several models which were joined in three categories. Such models reflected the diversity and regularity that are present inside the elaborated reasoning to solve the conflicts shown by us. We conclude that the diversity of organizer models identified shows the importance of the contents in the construction of moral reasoning.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVE: To adapted the critical velocity (CV), RAST test and lactate minimum (LM) to evaluation of female basketball players. METHODS: Twelve well-trained female basketball players (19 ± 1yrs) were submitted to four intensities running (10 - 14 km/h) at shuttle exercise until exhaustion, applied on alternate days. The linear model 'velocity vs. 1/tlim' was adopted to determine the aerobic (CV) and anaerobic (CCA) parameters. The lactate minimum test consisted of two phases: 1) hiperlactatemia induction using the RAST test and 2) incremental test composed by five shuttle run (20-m) at 7, 8, 9, 10, and 12 km/h. Blood samples were collected at the end of each stage. RESULTS: The velocity (vLM) and blood lactate concentration at LM were obtained by two polynomial adjustments: lactate vs. intensity (LM1) and lactate vs. time (LM2). ANOVA one-way, Student t-test and Pearson correlation were used for statistical analysis. The CV was obtained at 10.3 ± 0.2 km/h and the CCA estimated at 73.0 ± 3.4 m. The RAST was capable to induce the hiperlactatemia and to determine the Pmax (3.6 ± 0.2 W/kg), Pmed (2.8 ± 0.1 W/kg), Pmin (2.3 ± 0.1 W/kg) and FI (30 ± 3%). The vLM1 and vLM2 were obtained, respectively, at 9.47 ±0.13 km/h and 9.8 ± 0.13 km/h, and CV was higher than vLM1. CONCLUSION: The results suggest that the non-invasive model can be used to determine the aerobic and anaerobic parameters. Furthermore, the LM test adapted to basketball using RAST and progressive phase was effective to evaluate female athletes considering the specificity of modality, with high success rates observed in polynomial adjustment 'lactate vs. time' (LM2).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Food habits of jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) were studied between November 2000 and November 2001, in a 24.9 km² area of secondary Atlantic Rainforest and eucalypt plantation, in the Serra de Paranapiacaba, São Paulo State, Brazil. Analyses of 26 fecal and regurgitate samples, obtained over a stretch of 570.1 km, showed the consumption of 19 prey items and 74 prey occurrences. Small mammals were the most frequent food item (42.5%), followed by birds (21%), reptiles (14%) and medium-sized mammals (3%). The percent occurrence (PO) suggests that the diet consisted mainly of small rodents (30%) and birds (21%). We recorded for the first time the predation of Viperidae snakes by P. yagouaroundi. Although having a large list of items and range of dietary niche breadths (Bsta = 0.76), our data show that jaguarundi prey mainly on small vertebrates (mammals, birds or reptiles), and even in tall tropical forests or eucalypt plantations, it preys mostly on animals that come to, or live on, the ground.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A new species of dactylogyrid monogenean, Apedunculata discoidea gen. n., sp. n. is described and illustrated from the gills of the freshwater fish Prochilodus lineatus (Valenciennes, 1837) in pisciculture ponds from Pirassununga, São Paulo, Brazil. Diagnostic characters of the new genus and species are: 1) vagina dextrolateral slightly sclerotised, opening anteriorly at level of copulatory complex; 2) copulatory organ coiled with two counterclockwise rings; 3) Accessory piece distal and not articulated; 4) body disk-shaped, lacking a peduncle.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Purpose: To evaluate the onset time and quality of peribulbar anesthesia with 1% ropivacaine associated or not with hyaluronidase 100 tru/ml for cataract extraction. Methods: Prospective, randomized, double-blind and controlled study including fifty-seven patients, scheduled to undergo peribulbar anesthesia for cataract extraction, allocated to two groups. Group C: 1% ropivacaine with addition of 100 tru/ml hyaluronidase, and Group S 1% ropivacaine, without hyaluronidase. The onset time for globe akinesia was studied at intervals of 2 minutes, using Nicoll's score. We evaluated pain by analogic score during the surgery and the necessity of complementing the anaesthesia. The peribulbar block was considered satisfactory when the Nicoll's score was less than 4. Results: The mean time of onset of block in group C was 4.07 minutes (± 3.24), and in group S 5.03 (± 3.28). There was no statistically significant difference between the groups. Both were similar regarding pain score, no pain was observed in 57.14% of group C, and in 68.97% of group S. The supplementary anesthetic was necessary in 2 cases of group C and in 3 cases of group S. Two cases of bradycardia (heart rate < 50 bpm) were observed during the surgery, and in one case administration of atropine IV was necessary. Conclusion: 1% ropivacaine provided a good quality of anesthesia for cataract extraction, with a faster onset of action in the group with hyaluronidase 100 iu/ml, although without significant difference.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

PURPOSES: 1) To verify the impact of the creation of the Single Technical Record (STR) at the University of Campinas (Unicamp) Hospital das Clínicas, on the preservation period of corneas which were used in elective penetrating keratoplasties, and 2) to compare the primary failure incidence in cornea penetrating keratoplasties regarding the periods before and after the creation of STR. METHODS: A retrospective study was conducted at the Unicamp Hospital, which evaluated 15 consecutive cornea penetrating keratoplasties between January 1st and April 30th, 2000 and 24 consecutive penetrating keratoplasties between May 1st and September 20th of the same year (corneas under the control of the STR), totaling 39 keratoplasties. RESULTS: The mean time between cornea preparation and transplantation was 3.8 days (±1.78) in the period before STR creation, and 6.0 days (±2.97) after STR creation, representing a 36.7% increase in the preservation time. There was a statistically significant difference (p=0.02) between the two groups. No corneal primary failure was observed among the 39 transplanted patients in both groups. CONCLUSION: Based on the results of this study, it can be concluded that this new concept of the State Transplantation System has caused a statistically significant increase in the conservation period of corneas, which may reduce the period of a clear transplant due to an increased loss of endothelial cells, as well as increase the primary failure incidence or result in a high number of corneas that cannot be used due to having exceeded the preservation time recommended by the literature.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

INTRODUCTION: In Divinolândia (SP), the Consortium of Development of São João da Boa Vista Region Policy (CONDERG), in partnership with State University of Campinas (UNICAMP), has founded an eyeglass store to produce low cost glasses to distribute freely to their customers. The purpose is to analyze the evolution and working process of CONDERG eyeglass store in the last 13 years, since its foundation. METHODS: Data were collected from CONDERG store files from 1988 to 2001. Data regarding the amount of spectacles produced per year, ability to increase the production and store feasibility were analyzed. RESULTS: In 13 years, 16,500 spectacles were supplied. Currently, 400 spectacles are delivered per month, being 200 supported by SUS and the other 200 by CONDERG's own resources. CONCLUSION: The 13-year operation of CONDERG eyeglass store, the free provision of 16,500 spectacles and the increase productive ability have shown this model feasibility.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Univesidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física