60 resultados para DETECTION CELL
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
Sickle cell disease (SCD) is a genetic disorder characterized by the production of abnormal hemoglobin that polymerizes at low oxygen concentrations, causing the erythrocyte to adopt a sickle-shaped morphology. SCD pathophysiology is extremely complex and can lead to numerous clinical complications, including painful vaso-occlusive crises (VOC), end-organ damage, and a shortened lifespan. An impressive number of investigational drugs are currently in early stages of clinical development with prospects for use either as chronic therapies to reduce VOC frequency and end-organ damage in SCD or for use at the time of VOC onset. Many of these agents have been developed using a pathophysiological-based approach to SCD, targeting one or more of the mechanisms that contribute to the disease process. It is plausible that a multi-drug approach to treating the disease will evolve in the coming years, whereby hydroxyurea (HU) (the only drug currently FDA-approved for SCD) is used in combination with drugs that amplify nitric oxide signaling and/or counteract hemolytic effects, platelet activation and inflammation.
Resumo:
Mitochondria are involved in energy supply, signaling, cell death and cellular differentiation and have been implicated in several human diseases. Neks (NIMA-related kinases) represent a family of mammal protein kinases that play essential roles in cell-cycle progression, but other functions have recently been related. A yeast two-hybrid (Y2H) screen was performed to identify and characterize Nek5 interaction partners and the mitochondrial proteins Cox11, MTX-2 and BCLAF1 were retrieved. Apoptosis assay showed protective effects of stable hNek5 expression from Hek293-T's cell death after thapsigargin treatment (2μM). Nek5 silenced cells as well as cells expressing a kinase dead version of Nek5, displayed an increase in ROS formation after 4h of thapsigargin treatment. Mitochondrial respiratory chain activity was found decreased upon stable hNek5expression. Cells silenced for hNek5 on the other hand presented 1.7 fold increased basal rates of respiration, especially at the electrons transfer steps from TMPD to cytochrome c and at the complex II. In conclusion, our data suggest for the first time mitochondrial localization and functions for Nek5 and its participation in cell death and cell respiration regulation. Stable expression of hNek5 in Hek293T cells resulted in enhanced cell viability, decreased cell death and drug resistance, while depletion of hNek5by shRNA overcame cancer cell drug resistance and induced apoptosis in vitro. Stable expression of hNek5 also inhibits thapsigargin promoted apoptosis and the respiratory chain complex IV in HEK293T cells.
Resumo:
Sickle cell retinopathy (SCR) develops in up to 30% of sickle cell disease patients (SCD) during the second decade of life. Treatment for this affection remains palliative, so studies on its pathophysiology may contribute to the future development of novel therapies. SCR is more frequently observed in hemoglobin SC disease and derives from vaso-occlusion in the microvasculature of the retina leading to neovascularization and, eventually, to blindness. Circulating inflammatory cytokines, angiogenic factors, and their interaction may contribute to the pathophysiology of this complication. Angiopoietin (Ang)-1, Ang-2, soluble vascular cell adhesion molecule-1, intercellular adhesion molecule (ICAM)-1, E-selectin, P-selectin, IL1-β, TNF-α, pigment epithelium derived factor (PEDF) and vascular endothelial growth factor plasmatic levels were determined in 37 SCD patients with retinopathy, 34 without retinopathy, and healthy controls. We observed that sICAM-1 is significantly decreased, whereas PEDF is elevated in HbSC patients with retinopathy (P=0.012 and P=0.031, respectively). Ang-1, Ang-2 and IL1-β levels were elevated in SCD patients (P=0.001, P<0.001 and P=0.001, respectively), compared to controls, and HbSS patients presented higher levels of Ang-2 compared to HbSC (P<0.001). Our study supports the possible influence of sICAM-1 and PEDF on the pathophysiology of retinal neovascularization in SCD patients.
Resumo:
6
Resumo:
As hypoxia-induced inflammatory angiogenesis may contribute to sickle cell disease manifestations, we compared the angiogenic molecular profiles of plasma from sickle cell disease individuals and correlated these with in vitro endothelial cell-mediated angiogenesis-stimulating activity and in vivo neovascularization. Bioplex demonstrated that plasma from steady-state sickle cell anemia patients presented elevated concentrations of pro-angiogenic factors (Angiopoietin-1, basic fibroblast growth factor, vascular endothelial growth factor, vascular endothelial growth factor-D and placental growth factor) and displayed potent pro-angiogenic activity, significantly augmenting endothelial cell proliferation, migration and capillary-like structure formation. In vivo neovascularization of Matrigel plugs was significantly greater in sickle cell disease mice, compared with non-sickle cell disease mice, consistent with an upregulation of angiogenesis in the disease. In plasma from patients with hemoglobin SC disease without proliferative retinopathy, anti-angiogenic endostatin and thrombospondin-2 were significantly elevated. In contrast, plasma from hemoglobin SC individuals with proliferative retinopathy displayed a pro-angiogenic profile and had more significant effects on endothelial cell proliferation and capillary formation than plasma of patients without retinopathy. Hydroxyurea therapy was associated with significant reductions in plasma angiogenic factor profile, in association with an inhibition of endothelial cell-mediated angiogenic mechanisms and neovascularization. Thus, sickle cell anemia and retinopathic hemoglobin SC individuals present a highly angiogenic circulating milieu, capable of stimulating key endothelial cell-mediated angiogenic mechanisms. Combination anti-angiogenic therapy for preventing progression of unregulated neovascularization and associated manifestations in sickle cell disease, such as pulmonary hypertension, may be indicated; furthermore, the benefits and drawbacks of the potent anti-angiogenic effects of hydroxyurea should be clarified.
Resumo:
Riboflavin (vitamin B2) is a precursor for coenzymes involved in energy production, biosynthesis, detoxification, and electron scavenging. Previously, we demonstrated that irradiated riboflavin (IR) has potential antitumoral effects against human leukemia cells (HL60), human prostate cancer cells (PC3), and mouse melanoma cells (B16F10) through a common mechanism that leads to apoptosis. Hence, we here investigated the effect of IR on 786-O cells, a known model cell line for clear cell renal cell carcinoma (CCRCC), which is characterized by high-risk metastasis and chemotherapy resistance. IR also induced cell death in 786-O cells by apoptosis, which was not prevented by antioxidant agents. IR treatment was characterized by downregulation of Fas ligand (TNF superfamily, member 6)/Fas (TNF receptor superfamily member 6) (FasL/Fas) and tumor necrosis factor receptor superfamily, member 1a (TNFR1)/TNFRSF1A-associated via death domain (TRADD)/TNF receptor-associated factor 2 (TRAF) signaling pathways (the extrinsic apoptosis pathway), while the intrinsic apoptotic pathway was upregulated, as observed by an elevated Bcl-2 associated x protein/B-cell CLL/lymphoma 2 (Bax/Bcl-2) ratio, reduced cellular inhibitor of apoptosis 1 (c-IAP1) expression, and increased expression of apoptosis-inducing factor (AIF). The observed cell death was caspase-dependent as proven by caspase 3 activation and poly(ADP-ribose) polymerase-1 (PARP) cleavage. IR-induced cell death was also associated with downregulation of v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homologue (avian)/protein serine/threonine kinase B/extracellular signal-regulated protein kinase 1/2 (Src/AKT/ERK1/2) pathway and activation of p38 MAP kinase (p38) and Jun-amino-terminal kinase (JNK). Interestingly, IR treatment leads to inhibition of matrix metalloproteinase-2 (MMP-2) activity and reduced expression of renal cancer aggressiveness markers caveolin-1, low molecular weight phosphotyrosine protein phosphatase (LMWPTP), and kinase insert domain receptor (a type III receptor tyrosine kinase) (VEGFR-2). Together, these results show the potential of IR for treating cancer.
Resumo:
Perineural invasion (PNI) and lymphovascular invasion (LVI) have been associated with the risk of local recurrences and lymph node metastasis. The aim of this study was to evaluate the prognostic impact of PNI and LVI in patients with advanced stage squamous cell carcinoma of the tongue and floor of the mouth. One hundred and forty-two patients without previous treatment were selected. These patients underwent radical surgery with neck dissection and adjuvant treatment. Clinicopathological data were retrieved from the medical charts, including histopathology and surgery reports. Univariate analysis was performed to assess the impact of studied variables on survival. Overall survival was negatively influenced by six tumour-related factors: increasing T stage (P = 0.003), more than two clinically positive nodes (P = 0.002), extracapsular spread of lymph node metastasis (P < 0.001), tumour thickness (P = 0.04), PNI (P < 0.001), and LVI (P = 0.012). Disease-free survival was influenced by PNI (P = 0.04), extracapsular spread of lymph node metastasis (P = 0.008), and N stage (P = 0.006). Multivariate analysis showed PNI to be an independent predictor for overall survival (P = 0.01) and disease-free survival (P = 0.03). Thus the presence of PNI in oral carcinoma surgical specimens has a significant impact on survival outcomes in patients with advanced stage tumours submitted to radical surgery and adjuvant radiotherapy/radiochemotherapy.
Resumo:
Pilocarpine is an alkaloid obtained from the leaves of Pilocarpus genus, with important pharmaceutical applications. Previous reports have investigated the production of pilocarpine by Pilocarpus microphyllus cell cultures and tried to establish the alkaloid biosynthetic route. However, the site of pilocarpine accumulation inside of the cell and its exchange to the medium culture is still unknown. Therefore, the aim of this study was to determine the intracellular accumulation of pilocarpine and characterise its transport across membranes in cell suspension cultures of P. microphyllus. Histochemical analysis and toxicity assays indicated that pilocarpine is most likely stored in the vacuoles probably to avoid cell toxicity. Assays with exogenous pilocarpine supplementation to the culture medium showed that the alkaloid is promptly uptaken but it is rapidly metabolised. Treatment with specific ABC protein transporter inhibitors and substances that disturb the activity of secondary active transporters suppressed pilocarpine uptake and release suggesting that both proteins may participate in the traffic of pilocarpine to inside and outside of the cells. As bafilomicin A1, a specific V-type ATPase inhibitor, had little effect and NH4Cl (induces membrane proton gradient dissipation) had moderate effect, while cyclosporin A and nifedipine (ABC proteins inhibitors) strongly inhibited the transport of pilocarpine, it is believed that ABC proteins play a major role in the alkaloid transport across membranes but it is not the exclusive one. Kinetic studies supported these results.
Resumo:
ANKHD1 (Ankyrin repeat and KH domain-containing protein 1) is highly expressed and plays an important role in the proliferation and cell cycle progression of multiple myeloma (MM) cells. ANKHD1 downregulation modulates cell cycle gene expression and upregulates p21 irrespective of the TP53 mutational status of MM cell lines. The present study was aimed to investigate the role of ANKHD1 in MM in vitro clonogenicity and in vivo tumourigenicity, as well as the role of ANKHD1 in p21 transcriptional regulation. ANKHD1 silencing in MM cells resulted in significantly low no. of colonies formed and in slow migration as compared to control cells (p < 0.05). Furthermore, in xenograft MM mice models, tumour growth was visibly suppressed in mice injected with ANKHD1 silenced cells compared to the control group. There was a significant decrease in tumour volume (p = 0.006) as well as in weight (p = 0.02) in the group injected with silenced cells compared to those of the control group. Co-immunoprecipitation and chromatin immunoprecipitation (ChIP) assays confirmed the interaction between p21 and ANKHD1. Moreover, overexpression of ANKHD1 downregulated the activity of a p21 promoter in luciferase assays. Decrease in luciferase activity suggests a direct role of ANKHD1 in p21 transcriptional regulation. In addition confocal analysis after U266 cells were treated with Leptomycin B (LMB) for 24 h showed accumulation of ANKHD1 inside the nucleus as compared to untreated cells where ANKHD1 was found to be predominantly in cytoplasm. This suggests ANKHD1 might be shuttling between cytoplasm and nucleus. In conclusion, ANKHD1 promotes MM growth by repressing p21 a potent cell cycle regulator.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The effects of aluminum (Al) on the activities of antioxidant enzymes and ferritin expression were studied in cell suspension cultures of two varieties of Coffea arabica, Mundo Novo and Icatu, in medium with pH at 5.8. The cells were incubated with 300 µM Al3+, and the Al speciation as Al3+ was 1.45% of the mole fraction. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione S-transferase (GST) were increased in Mundo Novo, whereas glutathione reductase (GR) and guaiacol peroxidase (GPOX) activities remained unchanged. SOD, GR, and GST activities were increased in Icatu, while CAT activity was not changed, and GPOX activity decreased. The expression of two ferritin genes (CaFer1 and CaFer2) were analyzed by Real-Time PCR. Al caused a downregulation of CaFER1 expression and no changes of CaFER2 expression in both varieties. The Western blot showed no alteration in ferritin protein levels in Mundo Novo and a decrease in Icatu. The differential enzymes responses indicate that the response to Al is variety-dependent.
Resumo:
FISH has been used as a complement to classical cytogenetics in the detection of mosaicism in sex chromosome anomalies. The aim of this study is to describe three cases in which the final diagnosis could only be achieved by FISH. Case 1 was an 8-year-old 46,XY girl with normal female genitalia referred to our service because of short stature. FISH analysis of lymphocytes with probes for the X and Y centromeres identified a 45,X/46,X,idic(Y) constitution, and established the diagnosis of Turner syndrome. Case 2 was a 21-month-old 46,XY boy with genital ambiguity (penile hypospadias, right testis, and left streak gonad). FISH analysis of lymphocytes and buccal smear identified a 45,X/46,XY karyotype, leading to diagnosis of mixed gonadal dysgenesis. Case 3 was a 47,XYY 19-year-old boy with delayed neuromotor development, learning disabilities, psychological problems, tall stature, small testes, elevated gonadotropins, and azoospermia. FISH analysis of lymphocytes and buccal smear identified a 47,XYY/48,XXYY constitution. Cases 1 and 2 illustrate the phenotypic variability of the 45,X/46,XY mosaicism, and the importance of detection of the 45,X cell line for proper management and follow-up. In case 3, abnormal gonadal function could be explained by the 48,XXYY cell line. The use of FISH in clinical practice is particularly relevant when classical cytogenetic analysis yields normal or uncertain results in patients with features of sex chromosome aneuploidy. Arq Bras Endocrinol Metab. 2012;56(8):545-51
Resumo:
A 33-year-old woman complained of unilateral eyelid edema and blurred vision. Initial ophthalmic examination disclosed anterior chamber reaction with keratic precipitates on the cornea, without posterior abnormalities. Anterior uveitis was treated. Despite that, patient showed rapidly progressive unilateral vision loss with optic nerve swelling. Systemic workup was inconclusive, as well as cranial magnetic resonance imaging and cerebrospinal fluid examination. Based on the hypothesis of optic neuritis, intravenous methylprednisolone pulse was performed with no success. During the following days, the patient presented pericardial effusion and cardiac tamponade, progressing to death. Necropsy was performed and diagnosis of extranodal natural killers/T-cell lymphoma, nasal type with ocular involvement was confirmed by immunohistochemistry.