Flora arbustivo-arbórea do fragmento de floresta estacional semidecidual do Ribeirão Cachoeira, município de Campinas, SP

An inventory of the woody flora (trees and shrubs), was carried out in the Ribeirão Cachoeria forest (233.7ha, 650m high, 46°55'58''W, 22°50'13''S), the second largest and best conserved fragment of semideciduous tropical forest in the municipality of Campinas, São Paulo state, Southeastern Brazil. The soil is a red-yellow podsol and the climate is of Köppen's Cwag type. Collections were made from August/1996 to September/1997. Only fertile individuals with a perimeter at breast height of 9cm or greater were included in the survey. One hyndred and seventhy five species were identified, belonging to 119 genera and 49 families. The most important families were Myrtaceae (14 species), Rutaceae and Fabaceae (13), Caesalpiniaceae (11), Solanaceae (9), and Rubiaceae (8). Some species were found for the first time in the region: Tachigali multijuga Benth. and Schoepfia brasiliensis A.DC. The flowering peak for most species was from August to October. Maximum fruit production was from August to November. Most species are zoochoric (58%), but 23% were anemochoric and 19% autochoric. The floristic composition of this forest and another 20 forests from São Paulo state were compared. The results obtained indicate the existence of distinct groups of forests. The most homogeneus group contains forests from the municipality of Campinas with similarity of 40%. This suggests that these forests are possibly fragments of a original continuous forest in the Campinas region.

Florivory and sex ratio in Annona dioica St. Hil. (Annonaceae) in the Pantanal at Nhecolândia, southwestern Brazil

Annona dioica St. Hil. is a species that grows to approximately 2 m tall and is very widespread in the cerrados. Individual plants of this androdioecious species produce numerous hermaphroditic or male flowers, but few fruits. The aim of this study was to determine the sex ratio among the plants and to compare the frequency of herbivory between male and hermaphroditic flowers. The fieldwork was done by studying flowering plants in grasslands used as pasture for cattle at Fazenda Nhumirim. One hundred and forty-seven male plants and 71 hermaphroditic plants were examined and produced a total of 194 and 94 flowers, respectively, during the study period. The male:hermaphrodite sex ratio was 2.07:1, and was similar to the male:hermaphrodite flower ratio of 2.06:1. The frequency of florivory rate in hermaphrodites was significantly higher than in male flowers (33.0%, n = 31, and 25.7%, n = 50, respectively; G = 14.83; d.f. = 1; p < 0.001). The mean fresh weights of male and hermaphroditic flowers were significantly different (8.38 ± 2.40 g vs. 6.93 ± 2.68 g, respectively; 0 ± SEM; n = 50 each; t = 2.479; d.f. = 49; p = 0.017). These results indicate that the low fruit set in this species can be explained by the sex ratio, the greater herbivory of hermaphroditic flowers and the probable absence of pollinators.

Aspectos ultra-estruturais dos canais secretores em órgãos vegetativos e reprodutivos de Anacardiaceae

The study assessed phloem canal development and ultra-structure in shoot apices of Spondias dulcis G. Forst., phloematic canal ultra-structure in shoot apices of Tapirira guianensis Aubl., and floral canal ultra-structure and development and fruit canal ultra-structure of the latter specie. The flower and fruit canals of Anacardium humile St.Hil. were also studied ultra-structurally. The canals in shoot apices of S. dulcis show schizo-lysigenous formation and the floral canals of T. guianensis show schizogenous development. Epithelial cells of S. dulcis and T. guianensis canals have rough endoplasmic reticulum, free ribosomes, elongated plastids of several shapes with osmiophilic inclusions and dictyosomes with production of vesicles. Such organelles participate in the secretion of a heterogeneous exudate, which is comprised of hydrophilic and lipophilic substances. The epithelial cells of the fruit of A. humile present elongated plastids with circular membrane system, which are involved in the synthesis of lipophilic substances. The results of the ultra-structural analyses of the epithelial cells corroborate the results previously obtained in a histochemical study. In the histochemical study, lipophilic and hydrophilic substances were identified in the canals of T. guinanensis and S. dulcis and only lipophilic substances were identified in the canals of A. humile. Based on the ultrastructural aspects of the secretory canals of T. guianensis and S. dulcis we concluded that the plastids of the epithelial cells of the two species are different although they produce secretion of similar composition. A new record for the family is the presence of a great number of circular plastids in epithelial cells of the fruit of Anacardium humile. The pattern found in the secretory canals of the studied species is the ecrine type of secretion release.

Seed dispersal of Solanum thomasiifolium Sendtner (Solanaceae) in the Linhares Forest, Espírito Santo state, Brazil

The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of nativo vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous), and one species of lizard (Tropidurus torquatus) fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds), 19% (crab-eating fox) and 4% (lizards). Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control), bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.

Is size structure a good measure of future trends of plant populations? an empirical approach using five woody species from the Cerrado (Brazilian savanna)

Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.

Mixed rain forest in southeastern Brazil: tree species regeneration and floristic relationships in a remaining stretch of forest near the city of Itaberá, Brazil

The aim of this work was to evaluate the floristic composition, richness, and diversity of the upper and lower strata of a stretch of mixed rain forest near the city of Itaberá, in southeastern Brazil. We also investigated the differences between this conservation area and other stretches of mixed rain forest in southern and southeastern Brazil, as well as other nearby forest formations, in terms of their floristic relationships. For our survey of the upper stratum (diameter at breast height [DBH] > 15 cm), we established 50 permanent plots of 10 × 20 m. Within each of those plots, we designated five, randomly located, 1 × 1 m subplots, in order to survey the lower stratum (total height > 30 cm and DBH < 15 cm). In the upper stratum, we sampled 1429 trees and shrubs, belonging to 134 species, 93 genera, and 47 families. In the lower stratum, we sampled 758 trees and shrubs, belonging to 93 species, 66 genera, and 39 families. In our floristic and phytosociological surveys, we recorded 177 species, belonging to 106 genera and 52 families. The Shannon Diversity Index was 4.12 and 3.5 for the upper and lower strata, respectively. Cluster analysis indicated that nearby forest formations had the strongest floristic influence on the study area, which was therefore distinct from other mixed rain forests in southern Brazil and in the Serra da Mantiqueira mountain range.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.