Caracterização de dois equipamentos de beneficiamento e classificação de tomates para mesa

On the last years, in Brazil, sorting and classifying fruits and vegetables using packing lines have increased. This work aimed at characterizing the cleaning process for fresh market tomatoes at two packing lines, one imported and one national located at Campinas, São Paulo State. Characterization included data, number, types and brushes velocity, water use, fruit standing time and cleaning efficiency. Standing time was measured correlating to fruit diameter (CEAGESP). For measuring cleaning efficiency an equipment was developed that was mainly composed of a ring involved with white cloth. Samples were taken before and after the cleaning step and evaluated using a colorimeter HUNTER Lab. The results showed a strong difference between the two equipments. The imported equipment showed lower number on brushes and rotation than national one, however a higher water consumption. For imported equipments this relation was not found. Both packing lines showed the same cleaning efficiency. Cleaning efficiency is related to be an interaction among the studies parameters, and it could be necessary a better management than the one used on both equipments.

Caracterização morfoanatômica e histoquímica de Cuphea carthagenensis (Jacq.) J.f. Macbr. (Lythraceae)

Cuphea carthagenensis (Jacq.) J.F. Macbr. is an herb, which occurs preferably in wet places. Amongst other species of the genus, C. carthagenensis is distinguished for its great chemical potential and frequent use in popular medicine. In this study the morphological and anatomical structures were identified, as well as the histochemical characterization was done. Samples of root, stem and leaves were collected from adult plants. This material was processed for anatomical and histochemical analysis in light microscopy and for morphological analysis, in scanning electron microscopy. Important morphological and anatomical considerations were added for C. carthagenensis, such as: the occurrence of aerenchymatous phellem with suberized layers; the types of trichomes present in the vegetative organs, the characterization of secretory trichomes, as well as the secreted substances. The groups of secondary metabolites presents in the root, stem and leaf of C. carthagenensis with more intense histochemical reaction were: proanthocyanidins, phenolic compounds, acids polysaccharides (mucilage especially) and lipids.

A evolução da noção de parâmetros

This paper presents an overview of the concept of parameter in the Principles and Parameters theory, showing that a) in the first stage parameters were conceived as variation associated to the Principles and b) in the second stage as properties of the lexicon, and more specifically as properties of functional categories. The latter view has also developed from a substantive conception of functional categories to a more formal abstract characterization of functional heads. The paper also discusses parameters related to different levels of representation.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Paramentros fisiologicos, motores e morfologicos de bailarinas classicas

Universidade Estadual de Campinas . Faculdade de Educação Física