O estado da arte da cromatografia associada à espectrometria de massas acoplada à espectrometria de massas na análise de compostos tóxicos em alimentos

Chromatography combined with several different detection systems is one of the more used and better performing analytical tools. Chromatography with tandem mass spectrometric detection gives highly selective and sensitive analyses and permits obtaining structural information about the analites and about their molar masses. Due to these characteristics, this analytical technique is very efficient when used to detect substances at trace levels in complex matrices. In this paper we review instrumental and technical aspects of chromatography-tandem mass spectrometry and the state of the art of the technique as it is applied to analysis of toxic substances in food.

Preparação do (+)-±-terpineol a partir do (+)-limoneno: monoterpenos de odor agradável em um projeto para química orgânica experimental

A synthesis of (+)-±-terpineol from (+)-limonene was proposed as a project for undergraduate organic laboratory course. Terpineol is a useful flavor and fragrance compound, and several aspects of this preparation are suited for experimental organic classes, including basic techniques for extraction and analyses of essential oils, different reaction types and the possibility of a high degree of student interest.

Synthesis, characterization, DFT and Td-dfT study of the [Fe(mnt)(L)(t-BuNC) 2] octahedral complex (L = phen, bipy)

FeBr2 has reacted with an equivalent of mnt2- (mnt = cis-1,2-dicyanoethylene-1,2-dithiolate) and the α-diimine L (L = 1,10'-phenantroline, 2,2'-bipyridine) in THF solution, and followed by adding of t-butyl-isocyanide to give [Fe(mnt)(L)(t-BuNC)2] neutral compound. The products were characterized by infrared, UV-visible and Mössbauer spectroscopy, besides thermogravimetric and conductivity data. The geometry in the equilibrium was calculated by the density functional theory and the electronic spectrum by the time-dependent. The experimental and theoretical results in good agreement have defined an octahedral geometry with two isocyanide neighbours. The π→π* intraligand electronic transition was not observed for cis-isomers in the near-IR spectral region.

Estudo químico de Sinningia allagophylla guiado por testes de atividade antiproliferativa

Activity guided fractionation of Sinningia allagophylla (Mart.) Wiehler ethanolic extract yielded a new benzochromene 8-methoxylapachenol, besides seven known compounds: lapachenol, sitosteryl oleate, sitosteryl linoleate, stigmasteryl oleate, stigmasteryl linoleate, dunniol and tectoquinone. Extract, fractions, and compounds lapachenol, 8-methoxylapachenol, and dunniol were tested in vitro against human cancer cell lines U251 (glioma, CNS), MCF-7 (breast), NCI-ADR/RES (drug-resistant ovarian), 786-0 (kidney), NCI-H460 (lung, no small cells), PC-3 (prostate), OVCAR-3 (ovarian), HT-29 (colon), K562 (leukemia) and against VERO, a normal cell line. The most active compound was dunniol, which inhibited the growth of U251, MCF-7, NCI-ADR/RES, OVCAR-3 and K562 cell lines.

Ent-kaurane diterpenoids and other constituents from the stem of Xylopia laevigata (Annonaceae)

Phytochemical investigation of the hexane extract from the stem of Xylopia laevigata led to the isolation of the ent-kaurane diterpenoids, ent-kaur-16-en-19-oic acid, 4-epi-kaurenic acid, ent-16β-hydroxy-17-acetoxy-kauran-19-al, ent-3β-hydroxy-kaur-16-en-19-oic acid, and ent-16β,17-dihydroxy-kauran-19-oic acid, as well as spathulenol and a mixture of β-sitosterol, stigmasterol and campesterol. The identification of the compounds was performed on the basis of spectrometric methods including GC-MS, IR, and 1D and 2D NMR. Potent larvicidal activity against Aedes aegypti larvae with LC50 of 62.7 µg mL-1 was found for ent-3β-hydroxy-kaur-16-en-19-oic acid. This compound also showed significant antifungal activity against Candida glabrata and Candida dubliniensis with MIC values of 62.5 µg mL-1.

Ontogenia e estrutura do pericarpo de Prestonia riedelii (Müll. Arg.) Markgr. (Apocynaceae)

The aim of this work was to describe the morphology and ontogeny of P. riedelii fruits to aid in taxonomic, ecological and phylogenetic studies in Apocynaceae. Fruits were fixed in FAA, embedded in plastic resin, sectioned at 10 ìm and stained with toluidine blue, for structural analysis. The fruit of P. riedelii is a follicarium, with two follicular fruitlets. The epicarp is one-cell-layered, with trichomes and thick cuticle. The mesocarp, originating from fundamental ovary tissue, is parenchymatous with laticifers, non-lignified fibers and vascular bundles. The endocarp sensu lato is two-celllayered of crossed sclereids, originating from the inner ovary epidermis and from a single layer of parenchyma cells of fundamental ovary tissue. Follicle dehiscence is lateral and the dehiscence process involves anatomical characteristics such as a dehiscence zone with thin-walled cells, non-lignified fibers in the mesocarp and crossed sclereids in the endocarp.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Levotiroxina e o problema da permutabilidade de drogas de estreito intervalo terapêutico

The exchange of a prescribed drug by other similar, by generic products and even by custom products has become common practice in our country, often ignoring basic tenets of bioequivalence, interchangeability, stability and characteristics of the pharmaceutical compounds. In the case of drugs of narrow therapeutic index, such as levothyroxine, these problems are intensified, putting the effectiveness of treatment and patient health at serious risk. We review the pertinent legislation, emphasizing the characteristics of levothyroxine and adverse effects that limit the interchangeability of the compound.

46,XX DSD and Antley-Bixler syndrome due to novel mutations in the cytochrome P450 oxidoreductase gene

Deficiency of the enzyme P450 oxidoreductase is a rare form of congenital adrenal hyperplasia with characteristics of combined and partial impairments in steroidogenic enzyme activities, as P450 oxidoreductase transfers electrons to CYP21A2, CYP17A1, and CYP19A1. It results in disorders of sex development and skeletal malformations similar to Antley-Bixley syndrome. We report the case of a 9-year-old girl who was born with virilized genitalia (Prader stage V), absence of palpable gonads, 46,XX karyotype, and hypergonadotropic hypogonadism. During the first year of life, ovarian cyst, partial adrenal insufficiency, and osteoarticular changes, such as mild craniosynostosis, carpal and tarsal synostosis, and limited forearm pronosupination were observed. Her mother presented severe virilization during pregnancy. The molecular analysis of P450 oxidoreductase gene revealed compound heterozygosis for the nonsense p.Arg223*, and the novel missense p.Met408Lys, inherited from the father and the mother, respectively. Arq Bras Endocrinol Metab. 2012;56(8):578-85

Estudo comparativo das respostas autonomicas cardiovasculares entre corredores de provas de fundo, halterofilistas e sedentarios

Universidade Estadual de Campinas . Faculdade de Educação Física

Linguagem corporal de expressão da criatividade e seu (des)envolvimento na educação fisica

Universidade Estadual de Campinas. Faculdade de Educação Física