Análise bayesiana do modelo de herança monogênica no melhoramento vegetal: um exemplo com abobrinha

A common breeding strategy is to carry out basic studies to investigate the hypothesis of a single gene controlling the trait (major gene) with or without polygenes of minor effect. In this study we used Bayesian inference to fit genetic additive-dominance models of inheritance to plant breeding experiments with multiple generations. Normal densities with different means, according to the major gene genotype, were considered in a linear model in which the design matrix of the genetic effects had unknown coefficients (which were estimated in individual basis). An actual data set from an inheritance study of partenocarpy in zucchini (Cucurbita pepo L.) was used for illustration. Model fitting included posterior probabilities for all individual genotypes. Analysis agrees with results in the literature but this approach was far more efficient than previous alternatives assuming that design matrix was known for the generations. Partenocarpy in zucchini is controlled by a major gene with important additive effect and partial dominance.

Influência da idade no comportamento da frequência cardíaca na transição repouso-exercício: uma análise por deltas e regressão linear

BACKGROUND: Changes in heart rate during rest-exercise transition can be characterized by the application of mathematical calculations, such as deltas 0-10 and 0-30 seconds to infer on the parasympathetic nervous system and linear regression and delta applied to data range from 60 to 240 seconds to infer on the sympathetic nervous system. The objective of this study was to test the hypothesis that young and middle-aged subjects have different heart rate responses in exercise of moderate and intense intensity, with different mathematical calculations. METHODS: Seven middle-aged men and ten young men apparently healthy were subject to constant load tests (intense and moderate) in cycle ergometer. The heart rate data were submitted to analysis of deltas (0-10, 0-30 and 60-240 seconds) and simple linear regression (60-240 seconds). The parameters obtained from simple linear regression analysis were: intercept and slope angle. We used the Shapiro-Wilk test to check the distribution of data and the t test for unpaired comparisons between groups. The level of statistical significance was 5%. RESULTS: The value of the intercept and delta 0-10 seconds was lower in middle age in two loads tested and the inclination angle was lower in moderate exercise in middle age. CONCLUSION: The young subjects present greater magnitude of vagal withdrawal in the initial stage of the HR response during constant load exercise and higher speed of adjustment of sympathetic response in moderate exercise.

Análise tempo-intensidade dos estímulos doce e amargo de extrato de folhas de estévia [Stevia rebaudiana (Bert.) Bertoni] em doçura equivalente a sacarose

The extract of stevia leaves (Stevia rebaudiana Bertoni) is the only sweetener utilized in sucrose substitution which can be produced totally in Brazil. The objective of this study, was determine the temporal characteristic of sweet and bitter taste of stevia and compare with sucrose at 3 and 10% in the same equi-sweet. The time-intensity curves (T-I) for each substance were collected through the software Sistema de Coleta de Dados Tempo-Intensidade - SCDTI for Windows, where the judges recorded through of mouse the perception of each stimuli inside function of time, for each sample. The parameters of T-I curves collected were: time for intensity maxim (TImax), intensity maxim (Imax), time of decay (Td), time of plato (Platô), area under curve (Area) and total time of stimuli duration (Ttot). The parameters Td, Ttot, Area e Plato of T-I curves, for stimuli sweet in both sweetness level, were significativelly superior for stevia, while Timax e Imax were significativelly inferior (p£0,05), at differences between value for both substances were superior DESS at 10%. Sucrose didn?t present any record for simuli bitter as 3 as 10%, while stevia presented a characteristic T-I curve with intensity and total time of stimuli duration dependent of concentration.

Determinação de substitutos da manteiga de cacau em coberturas de chocolate através da análise de triacilgliceróis

Brazilian regulations prohibit the addition of cocoa butter replacements to chocolate, in total or partial substitution. The objective of the present work was to check the quality standards of four of coating bitter Brasilian chocolate bars and five of coating milk chocolate bars, commercialized in Campinas. In order to check the possible addition of substitutes, the triacylglycerol composition was determined, and the results were analysed by Padley & Timms mathematical method. The triacylglycerol composition of each sample was determined by high temperature gas chromatography (HTGC). The presence of cocoa butter replacements was not detected in the brands of coating chocolate.

Perfil sensorial de vinhos brancos varietais brasileiros através de análise descritiva quantitativa

Descriptive terminology and sensory profile of three varieties of brazilian varietal white wines (cultivars Riesling, Gewürztraminer and Chardonnay) were developed by a methodology based on the Quantitative Descriptive Analysis (QDA). The sensory panel consensually defined the sensory descriptors, their respective reference materials and the descriptive evaluation ballot. Ten individuals were selected as judges based on their discrimination, reproducibility and individual consensus with the sensory panel. Twelve descriptors were generated showing similarities and differences among the wine samples. Each descriptor was evaluated using a nine-centimeters non-structured scale with the intensity terms anchored at its ends. The collected data were analysed by ANOVA, Tukey test and Principal Component Analysis (PCA). The results showed a great difference within the sensory profile of Riesling and Gewürztraminer wines, whereas Chardonnay wines showed a lesser variation. PCA separated samples into two groups: a first group formed by wines higher in sweetness and fruitty flavor and aroma; and a second group of wines higher in sourness, adstringency, bitterness, alcoholic and fermented flavors.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

46,XX Male - Testicular Disorder of Sexual Differentiation (DSD): hormonal, molecular and cytogenetic studies

The XX male syndrome - Testicular Disorder of Sexual Differentiation (DSD) is a rare condition characterized by a spectrum of clinical presentations, ranging from ambiguous to normal male genitalia. We report hormonal, molecular and cytogenetic evaluations of a boy presenting with this syndrome. Examination of the genitalia at age of 16 months, showed: penis of 3.5 cm, proximal hypospadia and scrotal testes. Pelvic ultrasound did not demonstrate Mullerian duct structures. Karyotype was 46,XX. Gonadotrophin stimulation test yielded insufficient testosterone production. Gonadal biopsy showed seminiferous tubules without evidence of Leydig cells. Molecular studies revealed that SRY and TSPY genes and also DYZ3 sequences were absent. In addition, the lack of deletions or duplications of SOX9, NR5A1, WNT4 and NROB1 regions was verified. The infant was heterozygous for all microsatellites at the 9p region, including DMRT1 gene, investigated. Only 10% of the patients are SRY-negative and usually they have ambiguous genitalia, as the aforementioned patient. The incomplete masculinization suggests gain of function mutation in one or more genes downstream to SRY gene.

Six new cases confirm the clinical molecular profile of complete combined 17α-hydroxylase/ 17,20-lyase deficiency in Brazil

In 2004, Costa-Santos and cols. reported 24 patients from 19 Brazilian families with 17α-hydroxylase deficiency and showed that p.W406R and p.R362C corresponded to 50% and 32% of CYP17A1 mutant alleles, respectively. The present report describes clinical and molecular data of six patients from three inbred Brazilian families with 17α-hydroxlyse deficiency. All patients had hypogonadism, amenorrhea and hypertension at diagnosis. Two sisters were found to be 46,XY with both gonads palpable in the inguinal region. All patients presented hypergonadotrophic hypogonadism, with high levels of ACTH (> 104 ng/mL), suppressed plasmatic renin activity, low levels of potassium (< 2.8 mEq/L) and elevated progesterone levels (> 4.4 ng/mL). Three of them, including two sisters, were homozygous for p.W406R mutation and the other three (two sisters and one cousin) were homozygous for p.R362C. The finding of p.W406R and p.R362C in the CYP17A1 gene here reported in additional families, confirms them as the most frequent mutations causing complete combined 17α-hydroxylase/17,20-lyase deficiency in Brazilian patients.

Phenotypic variability in a family with x-linked adrenoleukodystrophy caused by the p.Trp132Ter mutation

X-linked adrenoleukodystrophy (X-ALD) is an inherited disease with clinical heterogeneity varying from presymptomatic individuals to rapidly progressive cerebral ALD forms. This disease is characterized by increased concentration of very long chain fatty acids (VLCFAs) in plasma and in adrenal, testicular and nervous tissues. Affected individuals can be classified in different clinical settings, according to phenotypic expression and age at onset of initial symptoms. Molecular defects in X-ALD individuals usually result from ABCD1 gene mutations. In the present report we describe clinical data and the ABCD1 gene study in two boys affected with the childhood cerebral form that presented with different symptomatic manifestations at diagnosis. In addition, their maternal grandfather had been diagnosed with Addison's disease indicating phenotypic variation for X-ALD within this family. The mutation p.Trp132Ter was identified in both male patients; additionally, three females, out of eleven family members, were found to be heterozygous after screening for this mutation. In the present report, the molecular analysis was especially important since one of the heterozygous females was in first stages of pregnancy. Therefore, depending on the fetus outcome, if male and p.Trp132Ter carrier, storage of the umbilical cord blood should be recommended as hematopoietic stem cell transplantation could be considered as an option for treatment in the future.

Proposição e avaliação de um método baseado em projeção de luz para reconstrução e análise da superfície do tronco durante a respiração

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise cinemática tridimensional do salto em distância de atletas de alto nível em competição

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise dos esforços de alta intensidade de jogadores de futebol profissional

Universidade Estadual de Campinas . Faculdade de Educação Física

Sistema de análise de movimento para avaliação da postura vertical durante a corrida no teste de esforço máximo incremental

Universidade Estadual de Campinas . Faculdade de Educação Física

Medida da capacidade antioxidante de fluidos biologicos por voltametria de pulso diferencial associada ao uso de surfactante como resposta as adaptações geradas pelo exercicio

Universidade Estadual de Campinas . Faculdade de Educação Física

Modelo para análise do ataque no futebol = : A model to analyze soccer offensive phase

Universidade Estadual de Campinas . Faculdade de Educação Física