46 resultados para Histological biomarker
Resumo:
Machado-Joseph disease (SCA3) is the most frequent spinocerebellar ataxia worldwide and characterized by remarkable phenotypic heterogeneity. MRI-based studies in SCA3 focused in the cerebellum and connections, but little is known about cord damage in the disease and its clinical relevance. To evaluate the spinal cord damage in SCA3 through quantitative analysis of MRI scans. A group of 48 patients with SCA3 and 48 age and gender-matched healthy controls underwent MRI on a 3T scanner. We used T1-weighted 3D images to estimate the cervical spinal cord area (CA) and eccentricity (CE) at three C2/C3 levels based on a semi-automatic image segmentation protocol. The scale for assessment and rating of ataxia (SARA) was employed to quantify disease severity. The two groups-SCA3 and controls-were significantly different regarding CA (49.5 ± 7.3 vs 67.2 ± 6.3 mm(2), p < 0.001) and CE values (0.79 ± 0.06 vs 0.75 ± 0.05, p = 0.005). In addition, CA presented a significant correlation with SARA scores in the patient group (p = 0.010). CE was not associated with SARA scores (p = 0.857). In the multiple variable regression, we found that disease duration was the only variable associated with CA (coefficient = -0.629, p = 0.025). SCA3 is characterized by cervical cord atrophy and antero-posterior flattening. In addition, the spinal cord areas did correlate with disease severity. This suggests that quantitative analyses of the spinal cord MRI might be a useful biomarker in SCA3.
Resumo:
The purpose of this study was to correlate the pre-operative imaging, vascularity of the proximal pole, and histology of the proximal pole bone of established scaphoid fracture non-union. This was a prospective non-controlled experimental study. Patients were evaluated pre-operatively for necrosis of the proximal scaphoid fragment by radiography, computed tomography (CT) and magnetic resonance imaging (MRI). Vascular status of the proximal scaphoid was determined intra-operatively, demonstrating the presence or absence of puncate bone bleeding. Samples were harvested from the proximal scaphoid fragment and sent for pathological examination. We determined the association between the imaging and intra-operative examination and histological findings. We evaluated 19 male patients diagnosed with scaphoid nonunion. CT evaluation showed no correlation to scaphoid proximal fragment necrosis. MRI showed marked low signal intensity on T1-weighted images that confirmed the histological diagnosis of necrosis in the proximal scaphoid fragment in all patients. Intra-operative assessment showed that 90% of bones had absence of intra-operative puncate bone bleeding, which was confirmed necrosis by microscopic examination. In scaphoid nonunion MRI images with marked low signal intensity on T1-weighted images and the absence of intra-operative puncate bone bleeding are strong indicatives of osteonecrosis of the proximal fragment.
Resumo:
In this study, we aimed to evaluate the effects of exenatide (EXE) treatment on exocrine pancreas of nonhuman primates. To this end, 52 baboons (Papio hamadryas) underwent partial pancreatectomy, followed by continuous infusion of EXE or saline (SAL) for 14 weeks. Histological analysis, immunohistochemistry, Computer Assisted Stereology Toolbox morphometry, and immunofluorescence staining were performed at baseline and after treatment. The EXE treatment did not induce pancreatitis, parenchymal or periductal inflammatory cell accumulation, ductal hyperplasia, or dysplastic lesions/pancreatic intraepithelial neoplasia. At study end, Ki-67-positive (proliferating) acinar cell number did not change, compared with baseline, in either group. Ki-67-positive ductal cells increased after EXE treatment (P = 0.04). However, the change in Ki-67-positive ductal cell number did not differ significantly between the EXE and SAL groups (P = 0.13). M-30-positive (apoptotic) acinar and ductal cell number did not change after SAL or EXE treatment. No changes in ductal density and volume were observed after EXE or SAL. Interestingly, by triple-immunofluorescence staining, we detected c-kit (a marker of cell transdifferentiation) positive ductal cells co-expressing insulin in ducts only in the EXE group at study end, suggesting that EXE may promote the differentiation of ductal cells toward a β-cell phenotype. In conclusion, 14 weeks of EXE treatment did not exert any negative effect on exocrine pancreas, by inducing either pancreatic inflammation or hyperplasia/dysplasia in nonhuman primates.
Resumo:
To evaluate p16(INK) (4a) immunoexpression in CIN1 lesions looking for differences between cases that progress to CIN2/3 maintain CIN1 diagnosis, or spontaneously regress. Seventy-four CIN1 biopsies were studied. In the follow-up, a second biopsy was performed and 28.7% showed no lesion (regression), 37.9% maintained CIN1, and 33.4% progressed to CIN2/3. Immunostaining for p16(INK) (4a) was performed in the first biopsy and it was considered positive when there was strong and diffuse staining of the basal and parabasal layers. Pearson's chi-square was used to compare the groups (p ≤ 0.05). The age of the patients was similar. There was no significant difference in p16(INK) (4a) immunoexpression in the groups, however, statistical analyses showed a significant association when only the progression and regression groups were compared (p = 0.042). Considering p16(INK) (4a) positivity and the progression to CIN2/3, the sensitivity, specificity, positive, and negative predictive values in our cohort were 45%, 75%, 47%, and 94%, respectively. We emphasize that CIN1 with p16(INK) (4a) staining was associated with lesion progression, but the sensitivity was not high. However, the negative predictive value was more reliable (94%) and p16(INK) (4a) may represent a useful biomarker that can identify CIN1 lesions that need particular attention, complementing morphology.
Resumo:
We report the case of a 73-year-old female who presented facial numbness and pain in the first division of the trigeminal nerve, ptosis, diplopia and visual loss on the right side for the previous four months. The neurological, radiological and histological examination demonstrated a rare case of invasive fungal aspergillosis of the central nervous system, causing orbital apex syndrome, later transformed in temporal brain abscess. She died ten months later due to respiratory and renal failure in spite of specific antimycotic therapy.
Resumo:
The input of agrochemicals in the aquatic compartment can results in biochemical injuries for living organisms. In this context, the knowledge of alterations of enzymatic activities due the presence of agriculture pollutants contributes for the elucidation of the mechanisms of toxicity, implementation of economic methods for monitoring purposes and establishment of maximum allowed concentrations. In the present work, the above considerations are discussed, and data concerning changes in enzymatic function by pesticides and fertilizer contaminants are reviewed. Also, we focused on the acid phosphatase due its susceptibility to several pollutants and diversity in cellular functions.
Resumo:
Dahlstedtia Malme (Leguminosae) is a neotropical genus, native to the Brazilian Atlantic Forest, and comprises two species, D. pinnata (Benth.) Malme and D. pentaphylla (Taub.) Burk., although it has been considered a monotypic genus by some authors. Leaf anatomy was compared to verify the presence of anatomical characters to help delimit species. Foliar primordium, leaflet, petiolule, petiole and pulvinus were collected from cultivated plants (Campinas, SP, Brazil) and from natural populations (Picinguaba, Ubatuba and Caraguatatuba, SP, Brazil - D. pinnata; Antonina, PR, Brazil - D. pentaphylla). Studies on leaflet surface assessment (Scanning Electron Microscopy), as well as histology and venation analyses were carried out of dehydrated, fresh and fixed material from two species. Leaflet material was macerated for stomatal counts. Histological sections, obtained by free-hand cut or microtome, were stained with Toluidine Blue, Safranin/Alcian Blue, Ferric Chloride, Acid Phloroglucin. Secretory cavities are present in the lamina, petiolule, petiole, pulvinus and leaf primordium in D. pentaphylla, but not in D. pinnata, and can be considered an important character for species diagnosis. Other leaf characters were uninformative in delimiting Dahlstedtia species. There is cambial activity in the petiolule, petiole and pulvinus. This study, associated with other available data, supports the recognition of two species in Dahlstedtia.
Resumo:
The copolymer poly (L-co-D,L lactic acid), PLDLA, has gained prominence in the field of temporary prostheses due to the fact that their time of degradation is quite compatible with the requirement in the case of osseous fracture. In this work the in vivo degradation of devices from copolymer, as a system of plates and screws, used in fixation of the tibia of rabbits was studied. The devices were implanted in 15 adult rabbits, albinos, New Zealand race, and they were used as control devices of alloys of titanium (Ti-6Al-4V/ V grade). The use of copolymers, synthesized in the laboratory, was tested in the repair of fracture in rabbits'tibias, being assessed in the following times: 2 weeks, 2 months and 3 months. Morphological analysis of tissue surrounding the plate and screw system, for 2 weeks of implantation, showed the presence of osteoblasts, indicating a pre bone formation. After 2 months there was new bone formation in the region in contact with the polymer. This bone growth occurred simultaneously with the process of PLDLA degradation, invading the region where there was polymer and after 3 months there was an intense degradation of the copolymer and hence greater tissue invasion compared to 2 months which characterized bone formation in a region where the polymer degraded. The in vivo degradation study of the devices for PLDLA by means of histological evaluations during the period of consolidation of the fracture showed the efficiency of plate and screw system, and it was possible to check formation of bone tissue at the implantation site, without the presence of inflammatory reaction
Resumo:
The aim of this study was to determine the effectiveness and reliability of laser fluorescence measurements in relation to occlusal caries diagnosis. DIAGNOdent 2095 (Kavo, Biberach, Germany), which has been developed especially for caries diagnosis, was utilized. Five (5) teeth were examined in the pilot test; after that, ten (10) teeth were examined in order to calibrate both examiners. Data were obtained from 66 teeth (36 molars and 30 premolars), totalizing 144 sites identified through photographs of the occlusal surfaces. Reproducibility was evaluated in 10 teeth. The interexaminer Spearman correlation (r) was 0.89 and the intra-examiner, 0.93 and 0.97 (examiner A and B, respectively). Validation was carried out by histological examination (stereomicroscope). For the two examiners the sensitivity of the device was relatively high, varying from 0.81 to 1.00, while specificity varied according to which validation criterion was used (0.77 - 0.86: enamel lesion / 0.52 - 0.59: dentin lesion). It was concluded that DIAGNodent presented good capacity of identifying any alteration of the dental surface, nevertheless it presents the disadvantage of accomplishing many false-positive diagnosis when the validation criterion is dentin lesion.
Resumo:
OBJECTIVE: To evaluate the positive predictive value for BI-RADS (Breast Imaging Reporting and Data System) categories 3, 4 and 5, correlating mammographic and histological diagnosis in non-palpable breast lesions. MATERIALS AND METHODS: Analytical-descriptive study of 169 women submitted to stereotactic localization for surgical biopsy of non-palpable breast lesions. Mammographic and histological findings were correlated, analyzing the predictive positive value for each category. RESULTS: Forty-two (24.8%) cases were diagnosed with breast cancer - only one in category 3, 19 in category 4, and 22 in category 5. The positive predictive value for categories 3, 4A, 4B, 4C and 5 were, respectively, 3.4%, 10.3%, 11.3%, 36% and 91.7%. Microcalcifications were the most frequent finding related to malignancy, present in 61.5% of these cases. CONCLUSION: The present study has demonstrated that BI-RADS allows a safe prediction of high suspicion of malignancy in lesions category 5 and low suspicion for category 3. As regards the category 4, the positive predictive value has shown a progressive increase in subcategories A, B and C, demonstrating that this subclassification represents an invaluable contribution for a more detailed and accurate assessment of lesions suspicious for malignancy.
Resumo:
The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
OBJECTIVE: Evaluate the efficacy of cumulative doses (CDs) of 131I-iodide therapy (RIT) in differentiated thyroid cancer (DTC). SUBJECTS AND METHODS: The probability of progressive disease according to CDs was evaluated in patients < 45 years old and > 45 years old and correlated to tumor-node-metastasis (TNM), thyroglobulin values, histological types and variants, age, and zduration of the disease. RESULTS: At the end of a follow-up period of 69 ± 56 months, 85 out of 150 DTC patients submitted to fixed doses RIT had no evidence of disease, 47 had stable disease and 18 had progressive disease. Higher CDs were used in the more aggressive variants (p < 0.0001), higher TNM stages (p < 0.0001), and follicular carcinomas (p = 0.0034). Probability of disease progression was higher with CDs > 600 mCi in patients > 45 years old and with CDs > 800 mCi in patients < 45 years. CONCLUSION: Although some patients may still respond to high CDs, the impact of further RIT should be carefully evaluated and other treatment strategies may be warranted.
Resumo:
Purpose: An experimental study to evaluate the behavior of polytetrafluoroethylene (Gore-Tex®) compared with human sclera, in scleral perforations induced in rabbits eyes was performed. Methods: Twenty-two eyes of rabbits were submitted to scleral perforation followed by Gore-Tex® graft in the left eye and human sclera graft in the right eye respectively. During one month the postoperative evolution was analyzed every day: intensity of hyperemia, presence of infection, secretion, rejection and tonicity of the eyes. Results: No cases of secretion, infection or rejection were observed. The histological sections showed fibrosis in the eyes with Gore-Tex®, good adhesion and epithelization. Conclusion: The Gore-Tex® showed to be a plausible material to be used as graft in scleral defects with some advantages such as easy obtention, good handling and durability.
Resumo:
PURPOSE: To evaluate the ocular surface toxicity of two nitric oxide donors in ex vivo and in vivo animal models: S-nitrosoglutathione (GSNO) and S-nitroso-N-acetylcysteine (SNAC) in a hydroxypropyl methylcellulose (HPMC) matrix at final concentrations 1.0 and 10.0 mM. METHODS: Ex vivo GSNO and SNAC toxicities were clinically and histologically analyzed using freshly excised pig eyeballs. In vivo experiments were performed with 20 albino rabbits which were randomized into 4 groups (5 animals each): Groups 1 and 2 received instillations of 150 µL of aqueous HPMC solution containing GSNO 1.0 and 10.0 mM, respectively, in one of the eyes; Groups 3 and 4 received instillations of 150 µL of aqueous HPMC solution-containing SNAC 1.0 and 10.0 mM, respectively, in one of the eyes. The contralateral eyes in each group received aqueous HPMC as a control. All animals underwent clinical evaluation on a slit lamp and the eyes were scored according to a modified Draize eye test and were histologically analyzed. RESULTS: Pig eyeballs showed no signs of perforation, erosion, corneal opacity or other gross damage. These findings were confirmed by histological analysis. There was no difference between control and treated rabbit eyes according to the Draize eye test score in all groups (p>0.05). All formulations showed a mean score under 1 and were classified as non-irritating. There was no evidence of tissue toxicity in the histological analysis in all animals. CONCLUSION: Aqueous HPMC solutions containing GSNO and SNAC at concentrations up to 10.0 mM do not induce ocular irritation.